1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amanda [17]
2 years ago
13

Each cell of the muscles of a certain bug contains 28 chromosomes.

Biology
1 answer:
Minchanka [31]2 years ago
6 0

Answer:

14 chromosomes

Explanation:

In the gametes of an organism, there are always half of how many chromosomes there are in the somatic cells of the organism. For example, if there are 4 chromosomes in the somatic cells, that means that there are 2 chromosomes in the gametes.

Somatic cells are body cells. They include everything from skin cells to brain cells to stomach cells.

Gametes are reproductive cells. They're the sperm and egg cells.

So if the muscle cells have 28 chromosomes, that means all somatic (or body) cells of that organism have 28 chromosomes.

So the gametes would have half of that amount:

28/2 = 14

So the sperm cells of this organism would have 14 chromosomes.

You might be interested in
Bryozoans have several different forms. The branching form is often mistaken for a type of coral. Which is true and can be used
-BARSIC- [3]

Answer:

Bryozoans belong to phylum bryozoa

while corals belong to phylum cnidaria.

Bryozoans are more advanced than corals.

bryozoans have an anus while corals do not have an anus

bryozoans tentacles don’t sting like corals.

4 0
3 years ago
This map shows the amount of soil moisture (SM), which is an indicator of water availability for people living in that region. B
vredina [299]

Answer:

The answer is 4

Explanation:

6 0
3 years ago
Read 2 more answers
How can two parents who show the dominant trait have offspring who shows the recessive trait? Give an example to support your an
natta225 [31]

Answer:

One example of a recessive inherited trait is a smooth chin, as opposed to a dominant cleft chin. Let (S) represent the dominant allele, and (s) represent the recessive allele. Only (ss) individuals will express a smooth chin. To determine the probability of inheritance of a smooth chin (or any other recessive trait), the genotypes of the parents must be considered. If one parent is heterozygous (Ss) and the other is homozygous recessive (ss), then half of their offspring will have a smooth chin.

Explanation:

7 0
3 years ago
HELP ASAP!!!!!!!<br><br>Fill in the blank ​
Aliun [14]
63 in water 100/g KNO3 Potassium nitrate
5 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • A unicellular microorganism was recovered from a hot spring (95°C) in Wyoming. The cells lack a nucleus, have a cell wall that l
    10·1 answer
  • What two layers make up skin? a. keratin and dermis c. epidermis and dermis b. epidermis and melanin d. melanin and keratin
    14·2 answers
  • The communities plus the abiotic surroundings are called the
    14·1 answer
  • A flowering containing make and female parts is called
    13·2 answers
  • The hives that Sally is experiencing are a result of an anaphylactic reaction. This is a multistep reaction resulting from the i
    10·1 answer
  • cockroaches are exposed to a pesticide, after 3 hours 95% of the insects are dead. what is the independent and dependent variabl
    7·1 answer
  • How did Watson and cricks model of DNA incorporate the research of other scientists ?
    12·2 answers
  • What are the structures and functions of water and nutrient transport in vascular plants ?​
    5·1 answer
  • Analyze the description of photosynthesis. The numbers which corrections should be made to describe
    15·1 answer
  • The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacterioph
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!