1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pochemuha
4 years ago
10

how does tourism and over hunting affect the populations of the Australian Freshwater Crocodile (Crocodylus Johnstoni) ???

Biology
1 answer:
DerKrebs [107]4 years ago
6 0
Tourism can affect the swamp water, if traveled on a boat, with all the oil and stuff that is needed to get the boat running, and over hunting, can slowly kill all the crocodiles that live there affecting the crocodile population! <span />
You might be interested in
What are two factors about particles that enable them to form solutions
otez555 [7]

Answer:

temperature and whether they are polar or non-polar

Explanation:

6 0
3 years ago
Which of these has a warming effect on Earth? O A. More evaporation of water due to warmer temperatures causes low, thick clouds
Phoenix [80]

Answer:

A

Explanation:

Thick clouds can trap lots of heat. This has a warming effect on earth.

4 0
3 years ago
Fill In the blank as shown below.
deff fn [24]
30 degrees Celsius.
8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The nasal cavity is divided into left and right portions by the
blondinia [14]

Answer:

The correct answer will be- nasal septum

Explanation:

The nasal cavity is the hollow space or cavity connected to the two nostrils which allow the inhalation and exhalation of the air into the nose.

The nasal cavity is divided into left and right portion by a cartilaginous bony structure called nasal septum. The nasal septum lies in the central position and divides the nasal cavity into symmetrical portions.  

Thus, the nasal septum is the correct answer.

6 0
3 years ago
Other questions:
  • A population of snail darters is drastically reduced by the introduction of a large predator fish into an isolated stream. the p
    9·1 answer
  • A flower's sepal is part of the corolla.<br> True/False?
    5·1 answer
  • As DNA replication continues and the replication bubble expands, the parental double helix is unwound and separated into its two
    5·1 answer
  • Photosynthesis releases a particular gas as a
    5·2 answers
  • On a very foggy day, humidity would probably reach what temperature?
    8·1 answer
  • What cellular structures can be observed with the aid of light microscopy and electron microscopy?​
    14·1 answer
  • What is a pesticide?
    6·1 answer
  • What do humans call their source of energy
    5·2 answers
  • 3) Which of the following is made by your body following the injection of a vaccine for a
    10·1 answer
  • scientists use the term _____________ to describe the concept of energy flow through living systems, such as cells.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!