1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
3 years ago
10

In humans, the "A" allele codes for Type A blood, the "B" allele codes for Type B blood, and the "o" allele codes for Type O blo

od. "A" and "B" are both dominant to "o." A and B are codominant to each other.
What is the genotypic ratio of a cross between a mother who is heterozygous Type A and a father who is heterozygous Type B?

A. 1 AB : 1 A0:1 Bo : 1oo

B. All AB

C. 2 AA: 2 BB

D. 1 Ao: 2 00:1 Bo​
Biology
1 answer:
Vladimir [108]3 years ago
5 0
Heterozygous means having two different alleles.
The A allele and B allele are dominant. This means that they will be the main allele to express itself. If someone has an A and an o allele, which is recessive, the A allele would express itself over the o allele. A and B are codominant - meaning that if someone had both A and B alleles they’d have type AB blood, as they’d both express.

The mother is heterozygous type A - that means she has one A allele and one o allele
The father is heterozygous type B - meaning he has one B allele and one o allele. I know that it is Bo because if it was BA then he’d have type AB blood because the A and B alleles are codominant.

The genotype ratio is a ratio saying what the chances are of having one type of something (ex blood type, eye color) given the alleles of parents. To find this out make a punnet square with A o on top and B o on the side. Fill it in. I’ve attached a pic of what it will look like.

As you can see 1/4 is AB, 1/4 is Ao, 1/4 is Bo and 1/4 is oo. So the ratio will be letter A: AB:Ao:Bo:oo

You might be interested in
Which of the following might be a pioneer species in an area where there was recently a lava flow? Choose all that apply. Select
Stella [2.4K]

The answer is most likely to be lichen.

8 0
4 years ago
The region inside the cell except for the nucleus is called ...? hurry to answer plz
Roman55 [17]
No idea but hopefully this cheers you up!

4 0
3 years ago
Read 2 more answers
In a plant cell wall the layer that is between a membrane, adding additional protection and support; not found in all plant cell
Tomtit [17]

Answer: SECONDARY CELL WALL.

Explanation: When cell wall grow,it becomes thickened,then it further deposits new layers of a different material (different from that of the primary cell wall) from where secondary cell wall is formed.

This secondary cell wall is made up of cellulose,hemicellulose,and lignin.

They function in providing additional strength,support, rigidity to cells and the larger plant.

8 0
3 years ago
Read 2 more answers
If exponential growth occurs in the population of a species of predator, the population of its prey will most likely ?
Sedbober [7]

Answer:

decrease quickly

Explanation:

3 0
3 years ago
Read 2 more answers
Whats the smallest functional unit in a multicelluar oraganism?
Lilit [14]

Answer:

The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Question 1 (1 point)
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • True or false? DNA is the shortened form of the term ‘Deoxyribonucleic acid’?
    12·2 answers
  • As we increase our latitude heading south (towards the Antarctic), we can expect the vegetation to:
    9·1 answer
  • How could the botanist best determine whether the genotype of the green-pod plant is homozygous or heterozygous?
    8·1 answer
  • What is used to prevent a viral infection?
    13·1 answer
  • In an exothermic reaction, the products in the activation energy curve are located ________ the reactants.
    15·1 answer
  • True or false: animals contribute most of the organic remains that form humus
    10·1 answer
  • The cytoplasm of a cell is at ph7 and the interior of an organelle is ph8
    11·1 answer
  • 4. Evaporation is the process of a liquid becoming solid.<br> TRUE OR FALSE:
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!