1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxx [7]
2 years ago
6

What two main ways cause genetic disorders?

Biology
2 answers:
Lady_Fox [76]2 years ago
7 0

Answer:

Mutation in genes or by damage to chromosomes

Explanation:

Elden [556K]2 years ago
7 0
Mutation by genes or by damage of organisms and chromosomes
You might be interested in
Water reabsorption through the proximal convoluted tubule is termed obligatory water reabsorption, whereas water reabsorption th
ratelena [41]
This is True . the reabsorption through the proximal tubule is obligatory 80% whereas water reabsorption through distal tubule is facultative but mostly through collector tubules 15 % ( under the action of aldosteron and antidiuretic hormone).
4 0
3 years ago
How many poles does Jupiter’s magnetosphere have? a. 2 c. 8 b. 4 d. 9
serious [3.7K]

Answer:

A. 2

Explanation:

I was wrong the first time, I wasn't thinking of jupiter for some reason. sorry!

6 0
3 years ago
Read 2 more answers
Warm currents originate ?
irga5000 [103]

They originate near the Equator!

7 0
3 years ago
Which process produces more ATP aerobic, or anaerobic respiration??
Valentin [98]

Answer:

aerobic

Explanation:

has far more energy therefore produces more ATP

6 0
2 years ago
Read 2 more answers
What trait most likely evolved in ferns that was not
nata0808 [166]

HI Mate! The right answer is vascular tissue!

5 0
3 years ago
Other questions:
  • Plants can reduce global warming, because photosynthesis requires _______.
    5·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 5. List three mechanisms by which Earth's albedo can be increased.
    5·1 answer
  • Nhen you are finished with the experiment, complete the following data analysis and submit your answe 1. Determine the volume of
    13·2 answers
  • What is point source pollution?
    14·1 answer
  • Why do different animals have different lifespan expectancy?
    7·2 answers
  • Which type of organism can obtain energy directly from any of the other organisms in an ecosystem?
    12·1 answer
  • the crust is made of rock and the mental is also made of rocks.if this is so then why the crust os floating on the mental​
    5·2 answers
  • When looking at each pair, how many chromosomes<br> in each pair come from the mother and father?
    14·2 answers
  • What is fulgurite? ? ?????????????
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!