During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
Explanation:
This is because, during lytic cycle,
During the lytic cycle, genome willing f the virus always undergo replication and transcription and the enzymes then degraded the bacteria chromosomes which has been coded by the viral genome to produce deoxyribonucleotides that acts as monomers to in order to produce more viral DNA so that virus will be replicated the more.
The virus find it's way into the the bacteria, then take over the whole macromolecular production and degrade components that are in existence in bacteria so as to get new materials to replicate alot of copies of itself.
Answer:
<h2>C.</h2>
Explanation:
This theory tells us that all cells come from existing cells, means all living cells come from the division of pre-existing cells. They do no come spontaneously from non- living matter as early believed. All pre-existing cells divide to form new cells by mitosis or meiosis. New cells never come from non-living matter suddenly, they only come from cell only.
The answer to the question is b
Answer: In primary succession, newly uncover or newly found rock is populated by living things for the first time. In secondary succession, an district before it was populated by living things is disturbed, and then re-populated after the disturbance.
Explanation: