1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ELEN [110]
3 years ago
9

Name three ways that humans benefit from the use of seedless plants

Biology
1 answer:
AleksandrR [38]3 years ago
6 0

Answer:

They support life by being the first vegetation to spring up on harsh terrain where soil is scarce. Even when they perish, seedless plants give back to nature. Certain seedless plants like moss and liverworts actually leave behind a layer of fertile soil for other plants when they perish.

Explanation:

Seedless plants have historically played a role in human life through uses as tools, fuel, and medicine. Dried peat moss, Sphagnum, is commonly used as fuel in some parts of Europe and is considered a renewable resource.

You might be interested in
Sponges can be found in both marine and freshwater environments. True or False
aniked [119]

Answer:

The answer is True

Explanation:

Hope this helps.

7 0
4 years ago
Your little cousin athena wants to know why she has crayons called blue-green and orange-yellow but none called blue-yellow or o
Sedaia [141]
If a color is a mix of blue and yellow, then it will just be green. and orange-green would turn to a weird color
4 0
4 years ago
If 2 organisms are in the same phylum, they are also in the same ____________.
Marina86 [1]
The answer would be kingdom
7 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Connie needs to choose a current event to write about for the school newspaper. Her teacher would also like the article to inclu
damaskus [11]
I dont understand what you mean but importance wise the picture would be most impotant
6 0
3 years ago
Other questions:
  • Germination
    6·1 answer
  • Which of the following classifications of matter includes materials that can no longer be identified by their individual propert
    15·1 answer
  • In your own words, explain how the planets Venus and Mercury can be located in the night sky.
    9·2 answers
  • After completing 10 years of experimentation, a scientist reports a
    15·1 answer
  • Suppose that a scientist proposes a hypothesis about how a newly discovered virus affects humans. Other virus researchers would
    11·2 answers
  • In the body, why do muscle cells and skin cells look and behave differently? Their genes are being expressed differently. The sa
    11·1 answer
  • What three units make up a nucleotide?
    15·1 answer
  • Which is the most abundant chemical found in living cells?
    14·1 answer
  • Smallholders have historically been for-profit commercial horticulturalists rather than subsistence farmers.
    12·1 answer
  • Where are earthquakes MOST LIKELY to occur?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!