1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ankoles [38]
2 years ago
14

Is the thermos considered a conductor or insulator?

Biology
1 answer:
Kruka [31]2 years ago
4 0

Answer:

an insulator

.........

You might be interested in
The belly buttom is located on the ___ Surface
yanalaym [24]

Answer: B ventral

Explanation: because ventral is the underside of a plant person animal etc.

4 0
3 years ago
The ______ promotes the development of businesses focusing on clean energy. environmental protection agency (epa) clean energy i
Bess [88]
Mission innovation is the key
5 0
3 years ago
In a single day, two 19 year old women and one 20 year old man sought treatment at a university health clinic, complaining of ac
LuckyWell [14K]

Answer:

delightful garden salad of fresh organic lettuces, sprouts, tomatoes, and cucumbers with zesty raspberry vinaigrette dressing.

Stool MCs is recommended

Salmonella typhi

It appears pink rod. Its a gram negative bacteria

7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Click on the link Lymphatic System
poizon [28]

Answer:

Explanation:

Lymphatics join up to form up larger lymph vessel than gradually transport the lymph back to the large veins that run just beneath the collarbone called the subclavian veins.

8 0
2 years ago
Other questions:
  • Biological species are reproductively isolated what does this mean
    6·1 answer
  • HELP!! 40 POINTS - i'm very confused on what to do
    11·2 answers
  • 30 points if ALL three answers correctly! urgent
    13·1 answer
  • The fourth reaction involving Gly-4 ( aldolase) is an especially important reaction in glycolysis. Why is this?
    9·1 answer
  • The idea that the brain is extremely malleable and is continuously chainging as a result of injury, experiences, or substances i
    7·1 answer
  • How have human activities increased atmospheric carbon dioxide levels?
    5·1 answer
  • Wind farms are set up to use the energy of wind for the generation of electricity. What is the ecological problem of using wind
    6·2 answers
  • Which type of microscope can produce three-dimensional images of a cell’s surface?
    8·1 answer
  • A 60kg person climbs stairs of total height of 20m in two minutes.calculate the power delivered.g:10ms
    15·1 answer
  • When Watson and Crick built and proposed the DNA structure, they determined three important features. What were the three featur
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!