All categories

3 years ago

Why is rna a polymer and a macromolecule

Biology

1 answer:

statuscvo [17]3 years ago

7 0

Answer:

RNA is a polymer because it is made up of many monomers called nucleotides. Moreover, RNAs can form macromolecules because many RNAs are large molecules (i.e., polynucleotide chains).

Explanation:

Ribonucleic acid (RNA) can be defined as a single-stranded nucleic acid polymer of the four nucleotides. In RNA, each nucleotide is composed of a 1-ribose sugar, a 2-phosphate group and 3-one of four types of nitrogenous bases: Adenine (A), Cytosine (C), Guanine (G), and Uracil (U), which are covalently bonded to form polynucleotide chains. There are different types of RNAs such as mRNA, tRNA, rRNA, miRNA, circ-RNAs, lncRNAs, etc. Many of these RNAs form large single-stranded (ss) molecules, i.e., polynucleotide chains. For example, an mRNA sequence may have a length of 5,000 nucleotides (5 kb) or even more, and there are RNA viruses that have more than 20000 nucleotides (20 kb) in length.

You might be interested in

Draw the structure of ethanamine.

valina [46]

Umm is this it??? if it isnt thennnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn irdk

6 0

3 years ago

20. How did HeLa cells make it possible to diagnose trisomies like Down syndrome?

Rasek [7]

He La cells have play important role in the study of cancer and even in cancer therapies. He La cells are also used to diagnose trisomic disorders such as Down's Syndrome with the help of chromosome banding. Some genes present in the He La cells are used as markers and compared with the other cell line in question. Presence of the marker for Down's syndrome in the cell in question shows that the person is suffering from the disease.

6 0

3 years ago

What kind of organism is a heterotroph?

Harman [31]

<span>These organisms are called autotrophs. Autotrophs are also called 'self-feeders,' and they are able to produce energy from sunlight and carbon dioxide and are therefore known as 'producers.' The only autotrophs that we know of are plants and some types of algae. This makes all other organisms heterotrophs</span>

5 0

3 years ago

Read 2 more answers

When viewed during the day or during night the moon appears to move slowly across the sky from what sides?

Anettt [7]

It would move from east to west

7 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago