1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
docker41 [41]
3 years ago
15

To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disa

greement
Biology
1 answer:
prisoha [69]3 years ago
8 0

Answer:

paper bags jute bags , cotton bags might be used for the environment

You might be interested in
Atoms of which three elements could bond together to form an organic compound?
Anastaziya [24]

Answer:

b

Explanation:

carbon, hydrogen and oxygen

3 0
3 years ago
Read 2 more answers
In which process does water from the plants to the air
mel-nik [20]

Answer:

Transporation

Explanation:

8 0
4 years ago
The __________ lobes make up one-third of the area of the cerebral cortex
ddd [48]
The frontal lobe takes about 1/3 of the cerebral cortex. 
8 0
3 years ago
If a cell in your body has 46 chromosomes it is said to benIf a cell in your body has 46 chromosomes it is said to be
Iteru [2.4K]

Answer:

<em>If a cell in your body has 46 chromosomes, it is said to be diploid.</em>

Explanation:

A diploid cell can be described as a cell that has chromosomes present in it in the form of pairs. There are 23 pairs of chromosomes in the autosomal cells of a human body. This means that in total there are 46 chromosomes in the autosomal cells.

However, the sex cells of the humans are haploid. The sex cells of humans have 23 chromosomes. The male and female sex cells unite to form diploid cell.

7 0
3 years ago
Pls help fast I need to turn this in for Hw​
Gnoma [55]

Answer:

justified you happy if you happy birthday to u all a very often in mele me a copy for you to know about it is the gveyx the yellow gold medal for gallantry and hi in yaru eilva you are doing good and I love it rain

Explanation:

y ok good frd antha helli kelana in the wandering river in the yellow and red wine and I love the gveyx you are interested then please send the

5 0
3 years ago
Other questions:
  • Observations involve interpretation.<br> True False
    12·1 answer
  • I do not understand these.
    5·1 answer
  • All plantlike protists are always eutrophic.<br> True or False
    5·2 answers
  • Why is water so susceptible to pollution?
    6·2 answers
  • How is a biological population different from the population of a whole ecosystem, such as a rainforest?
    13·1 answer
  • Why are horses and donkeys considered different species even though they can interbreed
    15·2 answers
  • Which statement best explains why meiosis produces haploid cells rather than diploid cells?
    11·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • I have an uno reverse card and I’m not afraid too use it &gt;:D
    5·1 answer
  • How much of the world’s population is fed by American farmers
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!