1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
11

10 examples of semi-metals​

Chemistry
2 answers:
Nookie1986 [14]3 years ago
6 0

Answer:

  • boron.
  • silicon.
  • germanium.
  • arsenic.
  • antimony.
  • tellurium.
  • polonium.

r-ruslan [8.4K]3 years ago
5 0
Carbon
aluminum
sulfer
tin
bismuth
astatine
boron
silicon
polonium
tellurium

hope this helps

mark brainliest plz
You might be interested in
Ethanol absorbs more energy than water because it has a lower heat capacity <br><br> True or false?
Bess [88]

Answer:

False

Explanation:

It makes sense

~Plz tap the crown~

~Thank you~

5 0
3 years ago
Please help me please please :(
Annette [7]

Answer:

B. and A.

Explanation:

May I have the Brainlliest award?

3 0
3 years ago
What is formed from nuclear decay? (2 points)
Anvisha [2.4K]

Answer:

B

Explanation:

A radioactive particle

7 0
3 years ago
Naturally occurring boron has an atomic mass of 10.810 amu consists of two isotopes. One of those isotopes is 10B with an isotop
miskamm [114]

Answer:

boron has an atomic mass of 10.810 amu consists of two isotopes.

4 0
4 years ago
Read 2 more answers
Complete and balance the following redox equation using the set of smallest whole– number coefficients. Now sum the coefficients
Elena L [17]

Answer : The balanced chemical equation in a acidic solution is,

BrO_3^-(aq)+6H^+(aq)+3Sb^{3+}(aq)\rightarrow Br^-(aq)+3H_2O(l)+3Sb^{5+}(aq)

The sum of the coefficients is, 17

Explanation :

Redox reaction or Oxidation-reduction reaction : It is defined as the reaction in which the oxidation and reduction reaction takes place simultaneously.

Oxidation reaction : It is defined as the reaction in which a substance looses its electrons. In this, oxidation state of an element increases. Or we can say that in oxidation, the loss of electrons takes place.

Reduction reaction : It is defined as the reaction in which a substance gains electrons. In this, oxidation state of an element decreases. Or we can say that in reduction, the gain of electrons takes place.

Rules for the balanced chemical equation in acidic solution are :

First we have to write into the two half-reactions.

Now balance the main atoms in the reaction.

Now balance the hydrogen and oxygen atoms on both the sides of the reaction.

If the oxygen atoms are not balanced on both the sides then adding water molecules at that side where the less number of oxygen are present.

If the hydrogen atoms are not balanced on both the sides then adding hydrogen ion (H^+) at that side where the less number of hydrogen are present.

Now balance the charge.

The given chemical reaction is,

BrO_3^-(aq)+Sb^{3+}(aq)\rightarrow Br^-(aq)+Sb^{5+}(aq)

The oxidation-reduction half reaction will be :

Oxidation : Sb^{3+}\rightarrow Sb^{5+}

Reduction : BrO_3^-\rightarrow Br^-

  • First balance the main element in the reaction.

Oxidation : Sb^{3+}\rightarrow Sb^{5+}

Reduction : BrO_3^-\rightarrow Br^-

  • Now balance oxygen atom on both side.

Oxidation : Sb^{3+}\rightarrow Sb^{5+}

Reduction : BrO_3^-\rightarrow Br^-+3H_2O

  • Now balance hydrogen atom on both side.

Oxidation : Sb^{3+}\rightarrow Sb^{5+}

Reduction : BrO_3^-+6H^+\rightarrow Br^-+3H_2O

  • Now balance the charge.

Oxidation : Sb^{3+}\rightarrow Sb^{5+}+2e^-

Reduction : BrO_3^-+6H^++6e^-\rightarrow Br^-+3H_2O

The charges are not balanced. Now multiplying oxidation reaction by 3 and then adding both equation, we get the balanced redox reaction.

Oxidation : 3Sb^{3+}\rightarrow 3Sb^{5+}+6e^-

Reduction : BrO_3^-+6H^++6e^-\rightarrow Br^-+3H_2O

The balanced chemical equation in acidic medium will be,

BrO_3^-(aq)+6H^+(aq)+3Sb^{3+}(aq)\rightarrow Br^-(aq)+3H_2O(l)+3Sb^{5+}(aq)

The sum of the coefficients = 1 + 6 + 3 + 1 + 3 + 3

The sum of the coefficients = 17

7 0
3 years ago
Other questions:
  • The science of the creation of maps and charts is called
    7·1 answer
  • Which of the compounds, c3h8, mgcl2, zn(no3)2, ocl2, are expected to exist as molecules?
    12·2 answers
  • Exactly 313.5 J will raise the temperature of 10.0 g of a metal from 25.0 C to 60.0 C. What is the specific heat of the metal?
    11·1 answer
  • Among the alkali metals, the tendency to react with other substances. A. does not vary among the members of the group. . B. incr
    10·1 answer
  • 25 L of a gas is collected at 115 kPa. If the pressure increases to 300 kPa, what is the new volume?
    9·1 answer
  • Based on the scientific sources you found, did you think one person’s points were more scientifically valid than the other’s
    9·2 answers
  • Say hiii for the camera
    9·2 answers
  • How is energy transferred when..
    15·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Use the chemical equation and the bond diagram to answer the question.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!