Answer:
selective permeability
Explanation:
The property or characteristic of cellular membrane to allow certain substances to pass through the cell is known as selective permeability. The movement of molecules and ions across the cell can be active or passive.
Answer and Explanation:
To calculate the allele frequency in the population, we divide the number of occurrences of the particular allele by total number of all alleles in the population Allele frequencies can be represented as a decimal, a percentage, or a fraction.
Given the population of white (W) and black (w) sheep, 22 out of 244 sheep are black, the frequency of the dominant allele in the population = 222/244×100=
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
False. Plants play a huge role in shaping the environment and ecosystem.
The average adult needs 1,000 mg of calcium per day in the body.
<h3>What is Calcium?</h3>
This is a chemical element with the symbol Ca and atomic number 20. It is involved in the strengthening of bones and teeth in the body so as to reduce risk of fracture.
Average adults require 1,000 mg of calcium per day for optimal functioning of body cells.
Read more about Calcium here brainly.com/question/103896
