Answer:
3. B. no new mating partners are available
7. D. best adaptations
8. C. survive and reproduce
Explanation:
Carrying capacity refers to the maximum population size of a species/population in a particular habitat. The carrying capacity depends on abiotic (e.g., shelter, water) and biotic factors (e.g., food, presence of mates). According to the evolutionary theory, individuals better adapted to their environments are more likely to survive and reproduce (i.e., produce more offspring) than other members of the same species. These 'better adapted' individuals will have more chances to pass their 'beneficial alleles' to the next generation.
The <u>urethra</u> is an organ which communicates with the lower bladder in order to enable excretion of urine from the body of a living organism.
<h3>What is an excretory system?</h3>
An excretory system refers to a living system that is saddled with the responsibility of removing waste products from the body of a living organism, so as to prevent damage to the body and help maintain homeostasis.
Based on scientific information, the <u>urethra</u> is an organ which communicates with the lower bladder in order to enable excretion of urine from the body of a living organism.
Read more on urethra here: brainly.com/question/877660
#SPJ12
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer: <u>Fascism</u> rejects the ideas of individual freedom and equality, instead arguing that hierarchies of superior and inferior are inherent in all human relationships.
Explanation:
Government that plays a role like a one party dictatorship followed fascism. In fascism nation's rights come before the rights of an individual. Countries that followed fascism run by a centralized government headed by a dictator. Fascists governments try to control all aspects of life including work, school,social and family life etc. Fascism is much common and practiced ideology around the time of world war 2. Large numbers of people were killed, who either didn't like or oppose fascism. And even many people were killed in the war initiated by fascist governments.
When two paired chromosomes harbor the same or identical alleles for a given characteristic at nearby loci, this condition is referred to as homologous (i.e. homologous chromosomes)a diploid organism or cell that has the same allele for both a maternal and paternal gene.
The term "homozygous" refers to the presence of the same or identical alleles for a given trait at related loci on paired chromosomes (i.e. homologous chromosomes). An entity with two sets of chromosomes is said to be diploid. Both sets are inherited; one set is from the mother and the other from the father. Based on their locations, each maternal chromosome can be matched with a corresponding paternal chromosome. Homozygous occurs when the same alleles are present at the loci in the corresponding chromosomes. It indicates that the same trait is coded for by both alleles.
A "homozygous" organism is one that carries two copies of either a pair of dominant alleles (such as AA) or a pair of recessive alleles for a given trait. genuinely reproducing organisms
Learn more about homozygous here:
brainly.com/question/376455
#SPJ4
