1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
2 years ago
15

What is term agriculture​

Biology
2 answers:
cestrela7 [59]2 years ago
6 0

Answer:

Agriculture is the process of producing food, feed, fiber and many other desired products by the cultivation of certain plants and the raising of domesticated animals (livestock). ... At the other end is commercial intensive agriculture, including industrial agriculture

Svetlanka [38]2 years ago
4 0

Answer:

It is the practice of farming such as cultivation and rearing animals to provide food.

Explanation:

Agriculture is the science of farming. :)

You might be interested in
1. Cytokinesis in plant cells result in the formation of a cell plate between the new cells , while cytokinesis in animal cells
Stella [2.4K]

Answer:

Yes it is right

Explanation:

8 0
2 years ago
What are the names of four polysaccharides and what is required for their formation?
dem82 [27]
The four polysaccharides are glycogen, starch, cellulose, and chitlin.  You consume them. They are sometimes artificially made or produced by your body.
7 0
2 years ago
Cell respiration begins with
irinina [24]

Answer:

Cell respiration begins with Glycolysis .

Explanation:

Glycolysis  is the first and initial step in the cellular respiration. Cellular respiration is the anaerobic process, which takes place in cytosol of the cells. Two molecule of pyruvate(CH3COCOO-) are formed from 1 molecule  of  glucose(C6H12O6)through glycolysis. The  NADH and  ATP are high energy molecules formed when the free energy are released. It is the process which takes place through a series of ten enzyme catalysed reactions. 10 enzymes are required to break down the sugar molecule. It occurs in cytoplasm.

8 0
2 years ago
The main advantage of solar energy is: A. It is low in cost. B. It can be used all the time. C. It has very little pollution. D.
Dmitrij [34]

C.  Solar energy's whole purpose it to reduce pollution in the air that fossil feuls do not. The answer cannot be A. B. or D. because 1. it is expensive 2. it can only be used during the daytime. It is a SOLAR panel. and 3. like is said earlier it is not free.


4 0
3 years ago
Read 2 more answers
Radiation , chemical agents , and viruses they may all cause ?
Ahat [919]
Mutations in the DNA
3 0
3 years ago
Read 2 more answers
Other questions:
  • Please help me in this question.
    8·1 answer
  • "why are more males than females affected by x-linked recessive genetic diseases?"
    5·1 answer
  • Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. e
    15·2 answers
  • In a breed of mice gray fur is dominant to white fur what letters will be used to represent the gray and white alleles
    14·2 answers
  • Because of volcanic activity on Iceland being very active, what type of energy would be produced ?
    14·1 answer
  • . How many electrons are in the n = 2 shell of the oxygen atom before bonding? eight electrons 2. What is the maximum number of
    9·2 answers
  • Scientists have discovered fossils on an island. What type of rock are they most likely examining?
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is the role of differentiation in creating different organs within the body?
    12·1 answer
  • Help will mark brainliest
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!