1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garri49 [273]
3 years ago
6

Greenhouse climate on earth was associated with relatively high atmospheric levels of which gas?

Biology
1 answer:
STALIN [3.7K]3 years ago
4 0
D.carbon dioxide gas
You might be interested in
Is the movement of water along the concentration gradient
Nuetrik [128]

Answer:

<em>- Is the movement of water along the concentration gradient: </em><em>Osmosis</em><em>. </em>

<em>- Is the use of energy to move the particles against the concentration gradient: </em><em>Active transport</em><em>. </em>

<em>- Is the movement of particles by diffusion without energy: </em><em>Simple diffusion</em><em>. </em>

<em>- Is the movement of particles along the concentration gradient: </em><em>Passive transport</em><em>.</em>

Explanation:

The mechanisms of cellular transport involve all the processes that the cell carries out to incorporate substances into its interior or send them to the extracellular space, through its semipermeable cell membrane.

<h3>- Osmosis</h3>

Is a type of transport that consists of the passage of water from a space with a lower concentration of solutes to one with a higher concentration, in order to reach equilibrium, following a concentration gradient.

The concentration gradient is given by the difference in concentration between two substances, which indicates the direction in which molecules, such as water, should move from one place to another.

<h3>- Active transport</h3>

Unlike passive transport mechanisms, which depend on a concentration gradient that determines the movement of particles, in active transport there are two characteristics that define it:

The passage of substances into the cell against a concentration gradient.

The use of energy to carry out this process.

In this case, the passage of substances through the cell membrane will be according to the requirements of the cell, or when they cannot pass through the membrane.

<h3>- Simple diffusion</h3>

According to the characteristics of the cell membrane, some substances can pass freely through it while others require special mechanisms. When a molecule is able to pass through the membrane without the use of special mechanisms or energy we speak of simple diffusion.

In a cell membrane, whose composition is by hydrophobic or non-polar lipid molecules, simple diffusion allows the passage of non-polar molecules, gases and alcohol.

<h3>- Passive transport</h3>

Refers to the mechanism of entry and exit of substances from the cell that does not require the use of energy.

The mechanisms involved in the passive transport of the cell are simple diffusion, osmosis, facilitated diffusion - which requires special conveyors or channels - and ultrafiltration, which depends on hydrostatic pressure. Examples of substances using this mechanism are lipid molecules, water and electrolytes.

Learn more:

Lipidic bilayer and cellular transport brainly.com/question/6955159

3 0
4 years ago
Which of the following choices lists the ways that you can show intellectual honesty in scientific communication.
Alika [10]

Answer:

<em>The correct option is A) Do not let your personal beliefs interfere with the truth; do not omit facts even if they contradict your hypothesis or your goals; avoid bias; do not make up data; do not plagiarize; give credit to others if you cite their work.</em>

Explanation:

Ethics and scientific research go hand in hand. If intellectual honesty and ethics are not maintained during scientific research, then this field could raise many ethical concerns.

Modifications in results are strictly against ethics during scientific research. A scientist should never try to manipulate the results so that it supports their hypothesis. Cheating or stealing other peoples work is also not acceptable in the scientific world. A scientist should always be modest.

5 0
3 years ago
True or false. the reptilian amniote egg with its protective outer layers is a landmark in evolution of life on land.
Mrrafil [7]

Answer:

TRUE

Explanation:

4 0
3 years ago
What is the proper way to carry a microscope
Readme [11.4K]
Usually by the neck or the metal piece of where you put your eye.
3 0
3 years ago
Read 2 more answers
What is another name for the phospholipid bilayer?
4vir4ik [10]
The answer is C. lipid membrane

The reason for this is, as stated in your question, it is called a phospholipid bilayer.

It's called like that because it is made out of lipids and it also has phosphate groups, while the bilayer part means it just has two layers. Therefore it is commonly also called a lipid membrane. 

6 0
3 years ago
Other questions:
  • What kind of relationship does temperature and density have?
    7·1 answer
  • What is the function of tomato in the preparation of swiss steak?
    9·1 answer
  • In a species of chickens, incomplete dominance between alleles for black (B) and white(w) feathers
    6·1 answer
  • An air mass gets its characteristic properties from an area known as the
    6·1 answer
  • Where is most of the water on Earth?
    5·1 answer
  • Which structure is represented by the X?
    5·2 answers
  • Which statement describes what will most
    7·1 answer
  • Explain how the gradient, load, and discharge of a stream will affect erosion. Use details to support your answer PLS HELP
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • How can disease transmission be traced to the original carrier?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!