1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka94
3 years ago
15

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby l

ambs has curly wool?
Biology
2 answers:
Greeley [361]3 years ago
7 0

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

azamat3 years ago
5 0

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

You might be interested in
As you travel from the surface of the earth up through the atmosphere into outer space, the gases become.A) more dense.B) less d
IgorC [24]
B: less dense hope this helps
4 0
3 years ago
Read 2 more answers
Amy was observing the growth of five kinds of flowering plants on a windowsill. She noticed that some of the flowers
8090 [49]

Answer: Flowers need sunlight

Explanation:

Flowers are attracted to the light because its wants makes them grow its kinda like humans  eating food well as a flower they need water air and sunlight as there food.

5 0
3 years ago
What is the function of the human immune system
pshichka [43]
The immune system<span> is made up of a network of cells, tissues, and organs that work together to protect the body. One of the important cells involved are white blood cells, also called leukocytes, which come in two basic types that combine to seek out and destroy disease-causing organisms or substances.</span>
6 0
3 years ago
Read 2 more answers
What would happen to the population of rock dwelling lizards if all rocks were romoved?
Mars2501 [29]
It would be renamed homeless lizards.
4 0
3 years ago
Read 2 more answers
The water cycle always begins with?
ddd [48]
It always starts with evaporation, because without water vapor (the byproduct of evaporation), there would be no clouds (they are made out of water vapor and some other particles). Henceforth, there will be no rain.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Do you think viruses should be classified as "living organisms"? why or why not?
    13·2 answers
  • WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!
    10·1 answer
  • Is a mushroom Eukaryotic or prokaryotic? why?
    9·2 answers
  • Which of these is an environmental effect of farming pesticides?
    5·2 answers
  • Different chemical elements will create a different scattering of absorption lines in the spectrum of visible light. We understa
    10·1 answer
  • Travels faster through a liquid than through a solid
    5·2 answers
  • Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • 1. Name a protein that carries vital materials throughout the body.
    14·1 answer
  • All vertebrate embryos have _____ at some point during embryonic development, indicating a common evolutionary ancestor
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!