1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gregori [183]
3 years ago
5

Why don't elephants get cancer?

Biology
1 answer:
FinnZ [79.3K]3 years ago
8 0

Answer:

D

Explanation:

Because don't have any p53 genes

You might be interested in
Do sharks live in the benthic ocean zone?
Elza [17]
Sharks don’t live in the benthic zone
4 0
3 years ago
The Institutional Review Board Committee's major concerns are protecting human research participants from physical or mental har
Sidana [21]

Answer: a. True

Explanation:

The main aim of the IRB is to safeguard the right of the human subjects used for the purpose of research conducted by the governmental authority. It also emphasizes over the protection of the researchers from illegal complaints. The risks to the human subjects can be minimized by using procedures which cause no harm to them and a detail consent of the research practice should be taken from these subjects by informing the purpose of research.

4 0
3 years ago
student designed an experiment testing the effect of light distance on the rate of photosynthesis. she placed samples of elodea
Leno4ka [110]

The amount of oxygen produced can be quantified in order to determine the rate of photosynthesis. Elodea leaves are divided into little pieces, and the cut ends are put into the funnel's stem.

<h3>What did Elodea's bubbles in this experiment represent?</h3>

The bubbles that you observe rising from an elodea cutting's leaves are actually a result of the photosynthesis process. In some types of algae and in plants, photosynthesis takes place. In the process, light energy is changed into a sort of chemical energy that is then stored as sugar.

<h3>What substance did we use to examine whether photosynthesis existed in Elodea?</h3>

To test whether photosynthesis and/or other processes are occurring, you will conduct experiments using the dye Phenol Red in this exercise. In Elodea plants, cellular respiration is taking place. The experiments look into how light affects these processes.

To know more about photosynthesis visit:-

brainly.com/question/1388366

#SPJ4

5 0
1 year ago
What would happen to the population of rock dwelling lizards if all rocks were romoved?
Mars2501 [29]
It would be renamed homeless lizards.
4 0
4 years ago
Read 2 more answers
The organelles that produce proteins used within the cell are the _____.
Schach [20]
The organelles that produce proteins used within the cell are the ribosomes. 

Final answer: Ribosomes. 
8 0
4 years ago
Read 2 more answers
Other questions:
  • Fewer living organisms are found at a desert, deep ocean or high mountain?
    11·1 answer
  • 1. If no oxygen is present what process occurs after glycolysis?
    13·1 answer
  • Which of these occurs during both photosynthesis and cellular respiration?
    13·2 answers
  • The two main areas of physical science are ____________ and _____________. ( separate your answers with a , ) (1 point)
    14·1 answer
  • What treatment is being compared to the control in the experiment?
    15·1 answer
  • In fruit flies, a specific gene mutation causes the wings to become malformed. These wings are called vestigial because they do
    8·1 answer
  • Why do we feel pain in our hearts when we are sad
    13·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Why is the Earth separated into different layers?
    6·1 answer
  • What will be the pulse rate if you meet a black bear in the forest
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!