1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleks [24]
2 years ago
13

What carbohydrate builds macromolecules​

Biology
1 answer:
salantis [7]2 years ago
6 0

Although most absorbed glucose is used to make energy, some glucose is converted to ribose and deoxyribose, which are essential building blocks of important macromolecules, such as RNA, DNA, and ATP.

You might be interested in
Robbie is trying to learn as much as he can about a rock that he found. This particular rock contains some fossils. What can Rob
Marrrta [24]
D. fossils will help you discover how old the rock is, fossils would not be included in the question if the answer does not relate to them
4 0
3 years ago
If a man weighs 190 lb and eats 150 g protein per day, his protein intake is _____ of the recommended dietary allowance (rda)
-BARSIC- [3]

The RDA for protein is 0.8 g per kilogram of body weight. This man's weight is 190 lb, or 86 kg; 86 kg × 0.8 = 69.1 g protein per day. Thus, an intake of 150 g is more than twice his RDA of 69.1 g of protein per day.

Recommended Dietary Allowance (RDA) of protein for adults is 0.8 g per kilogram of body weight. To determine your RDA for protein, multiply your weight in pounds by 0.36.The protein RDA for adults is 0.8 grams per kilogram of healthy body weight per day.

Proteins build muscle mass and contour, facilitate hair, nails and bone growth, regulate energy levels, and support chemical processes within the body which include enzyme, hormone and antibody production.

To learn more about Recommended Dietary Allowance ,here

brainly.com/question/11824881

#SPJ4

6 0
2 years ago
The most apparent difference between modern humans and Australopithecus africanus is that Australopithecus africanus
lara [203]

Answer:

The correct answer is option d.

Explanation:

An extinct species of australopithecine, that is, Australopithecus africanus was the first species to be illustrated. It was of gracile or slender build and was considered to have been the direct ancestor of modern humans. Like modern man, the A. africanus did stood upright and walked upright, and were having free hands to use. However, they were smaller in height and lighter in weight in comparison to modern man.

3 0
3 years ago
The tropical regions are warmer than the polar regions due to the angle of the Sun's rays. As a result, there is generally highe
Rashid [163]

Answer:

the answer is on letter B

Explanation:

like and follow me

3 0
3 years ago
Read 2 more answers
The____is used to study the similarities in different species from long ago and to reveal links between the species .
Darya [45]
It’s Molecular Homology
5 0
3 years ago
Read 2 more answers
Other questions:
  • The scientific name for a white oak is Quercia Alba; the scientific name for a red oak is Quercia Ribera what does this tell you
    12·1 answer
  • A homozygous dominant brown mouse is crossed with a heterozygous brown mouse (Tan is the recessive color). What are the genotypi
    10·1 answer
  • Pls help!!! 50 POINTSSSSSSSs
    11·2 answers
  • Behavioral ecology is based on which premise?
    9·1 answer
  • How do roots and seeds get energy?​
    12·2 answers
  • What is the nature of cell-walls in diatoms​
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • FOR BRAINLIEST!! PLEASE HELP!! Older people in town who were surveyed are more likely to go on daily walks than the younger peop
    10·2 answers
  • 6.L.14.4 Which is true of only animal cells?
    15·2 answers
  • Atoms are composed of ________ and ________. a nucleus; an electron shell a nucleus; an electron shell a nucleus; a membrane a n
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!