3 years ago

Test different combinations of stimuli and sense organs. Are there any cases where

1 answer:

6 0

Answer: thalamus

n one, a neuron works with a sensory receptor, a cell, or cell process that is ... In most cases, the correct stimulus impinging on a sensory receptor will drive .the brain can carry two signals at once, ... "We found that there are periods of time when a given neuron responds to one stimulus ... Our brains are capable of processing multiple stimuli at once -- such as ... "Our working memory system is quite limited

Explanation:

You might be interested in

What are those characteristics of a psychological test?

poizon [28]

Objectivity: The test should be free from subjective—judgement regarding the ability, skill, knowledge, trait or potentiality to be measured and evaluated. 2. Reliability: This refers to the extent to which they obtained results are consistent or reliable.

Can I have brain list pleaseeee

6 0

3 years ago

Sam had a disease that weakened his heart so it could not pump properly. This heart problem

Kamila [148]

Answer:

2. muscular system and cardiovascular system

6 0

3 years ago

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

3 years ago

1) Is a compound a mixture or a pure substance?

Rudiy27

I believe it is a Pure Substance

7 0

3 years ago

The _______ modifies vesicles for export or use within the cell. endoplasmic reticulum mitochondria Golgi apparatus nucleus

Anastasy [175]

I believe the answer is Golgi Apparatus.

8 0

4 years ago