1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
3 years ago
12

Need help on all of the blanks please

Biology
1 answer:
Fynjy0 [20]3 years ago
3 0

Epithelium

Skin

epidermis

the dermis

subcutaneous layer

epidermis

replaced

melanin

melanin

connective

blood vessels,

nerves,

hair roots,

oil glands,

and sweat glands

dermis

You might be interested in
Question 1
koban [17]

Answer:

Most tissues of the body grow by increasing their cell number, but this growth ... photography of a live plant cell nucleus undergoing mitosis.

5 0
3 years ago
Think about all of the figures that illustrate tracheids. What are the functions for tracheids? How can you identify a tracheid
kotykmax [81]

Answer: The tracheids have important functions in the plant.

Explanation: The mechanical support is provided by the lignified walls of tracheid cell. the helps in other functions of the plant such as transporting water and getting the solute from the root to the stem and eventually the leaf of the plant.

The tracheids are most useful in the gymnosperms where elements need to be transported.

Identifying a tracheid in a cross section is quire easy as the tracheid cells fit into each other neatly and piled up similarly and have identical shapes as well which makes them obvious from other cells.              

The two examples of tracheid plans could be

  • pteridophytes
  • gymnosperms  

The most common thing that could be found in traceid plant is that this cells are mainly present for transporting either water other solutes in the plant body.

4 0
3 years ago
Which of the following are reactants of photosynthesis?
OlgaM077 [116]

Answer:

C6H12O6 + 6O2 are reactants of photosynthesis

Explanation:

think it's the correct answer

pls mark me as the brainlliest

4 0
3 years ago
Read 2 more answers
What is at least one reason why science cannot help to answer ethical or moral social issues?
Varvara68 [4.7K]
Because what we do comes down to our own conscious and moral values. Also everyone responds to situations differently
7 0
3 years ago
In one fishing village in Alaska, the allele frequency of webbed feet is 0.10. This dominant trait causes affected individuals t
larisa86 [58]

Answer:

Phenotypic frequency of the dominant trait = 0.19 ⇒ the frequency of individuals in this village that have webbed feet

Explanation:

Due to technical problems, you will find the complete explanation in the attached files.

Download pdf
4 0
3 years ago
Other questions:
  • Describe Why :
    9·1 answer
  • Help! i’ll give brainliest
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Prokaryotes that live in almost every habitat are...
    14·1 answer
  • What are the two components of an ecosystem
    15·1 answer
  • scientists on mars have been investigating the genetic makeup of organisms in this community. use the information provided and y
    11·2 answers
  • Which of the following does mitochondrion undergo to provide energy for the cells?
    7·2 answers
  • 1) What two criteria are needed for triangles to be similar?<br> a)<br> b)
    10·1 answer
  • A.
    15·2 answers
  • Explain how the cohesive and adhesive properties of water are useful in maintaining various life processes.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!