1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
3 years ago
15

I would like this before 11:59 PM EST on Friday, March 26th 2021. Yes, this IS for a HOMEWORK assignment, so PLEASE DON'T DELETE

THIS. Thank you!
Propose an explanation for the wide diversity of minerals. Consider factors such as the elements that make up minerals and the Earth processes that form minerals.
Biology
1 answer:
lapo4ka [179]3 years ago
7 0

Answer:

Minerals can form in all geological environments, which allows them to have a wide range of chemical and physical conditions. Two forms of this are temperature and pressure. There are 4 main categories of mineral formations.   Igneous is where the minerals crystalize from a melt. Sedimentary is where the raw materials of the mineral are particles from other rocks that have suffered from erosion and weathering. Metamorphic is where new minerals are created from earlier ones owing to the effects of change. Most of the time it's from increasing temperature and/or pressure. Hydrothermal is where the minerals are chemically precipitated from hot solutions in the earth.

You might be interested in
Whats the biggest mystery about the virus​
dsp73

Explanation:

<em>Hey</em><em>,</em><em> </em><em>there</em><em>!</em><em>!</em>

<em>According</em><em> </em><em>to</em><em> </em><em>what</em><em> </em><em>i</em><em> </em><em>have</em><em> </em><em>learned</em><em>, </em><em>the</em><em> </em><em>biggest</em><em> </em><em>mystery</em><em> </em><em>about</em><em> </em><em>virus</em><em> </em><em>is</em><em>;</em><em> </em><em>It</em><em> </em><em>acts</em><em> </em><em>like</em><em> </em><em>both</em><em> </em><em>living</em><em> </em><em>and</em><em> </em><em>non-</em><em> </em><em>living</em><em> </em><em>beings</em><em>.</em>

<em>living</em><em> </em><em>characters</em><em> </em><em>includes</em><em> </em><em>:</em>

  • <em>It</em><em> </em><em>reproduce</em><em> </em><em>to</em><em> </em><em>make</em><em> </em><em>more</em><em> </em><em>no</em><em>.</em><em> </em><em>of</em><em> </em><em>themselves</em><em>. </em>
  • <em>It</em><em> </em><em>feeds</em><em> </em><em>on</em><em> </em><em>various</em><em> </em><em>substances</em><em>. </em>

<em>non-</em><em> </em><em>living</em><em> </em><em>characters</em><em>: </em>

  • <em>It</em><em> </em><em>can</em><em> </em><em>be</em><em> </em><em>crystallize</em><em>. </em>
  • <em>It</em><em> </em><em>dont</em><em> </em><em>respire</em><em> </em><em>and</em><em> </em><em>feed</em><em> </em><em>eith</em><em> </em><em>it</em><em> </em><em>is</em><em> </em><em>out</em><em> </em><em>from</em><em> </em><em>a</em><em> </em><em>host</em><em> </em><em>body</em><em>.</em>

<em><u>Hope</u></em><em><u> </u></em><em><u>it helps</u></em><em><u>.</u></em><em><u>.</u></em><em><u>.</u></em>

5 0
3 years ago
<img src="https://tex.z-dn.net/?f=what%20%5C%3A%20is%20%5C%3A%20cell%20%5C%3A%20%5C%3A%20%20%5C%3A%20%20%20%7B%3F%7D" id="TexFor
Rus_ich [418]

Answer:

Cells are the basic building blocks of all living things. The human body is composed of trillions of cells. Cells have many parts, each with a different function. Some of these parts, called organelles, are specialized structures that perform certain tasks within the cell

Explanation:

<h2>❣️(◍Jess bregoli◍)❣️</h2>

#keep learning!!

5 0
2 years ago
Read 2 more answers
Define the term peristalsis and explain why is it so important
satela [25.4K]

Answer:

Peristalsis is a series of wave-like muscle contractions that move food through the digestive tract. ... There, the food is churned into a liquid mixture called chyme that moves into the small intestine where peristalsis continues. Stretching out a piece of intestine will make it easier to see the wave-like motion

3 0
3 years ago
Read 2 more answers
What is the first step in the life cycle of a plant that reproduces sexually?
coldgirl [10]

Answer:

The most appropriate answer would be A sperm cell fertilizes an egg cell.

In sexually reproducing organisms including plants, life starts as a single-celled zygote which is formed by the fertilization of sperm and egg.

The zygote then divides through mitotic division to form an embryo.

After fertilization In angiosperms, the ovule matures to form seed and ovary matures to form fruit.

In gymnosperms, zygote develops into a new sporophyte.

6 0
3 years ago
Read 2 more answers
Explain why the smell of a hospital or dentist's office can bring about negative emotions, and why the smell of baking cookies o
aalyn [17]

Answer:

Most humans would associate the smell of the doctor's or dentist's with something bad or painful, when on the other hand baking cookies or having a nice smell of Thanksgiving can remind us of tasty food and comfort with family or just comfort in general.

Explanation:

Above ^^

8 0
2 years ago
Other questions:
  • How can evidence from an experiment in relationship to the hypothesis ​
    10·1 answer
  • The fur color in a colony of mice has been brown for many generations. One gene appears to code for the fur color pigment. In a
    8·1 answer
  • Enzymes in the digestive tract are composed of which of the following?
    11·1 answer
  • Which process provides environments that are conducive for marine ecosystems?
    15·2 answers
  • The consequences of artificial selection and the advantages and disadvantages of using genetic information in society. Use facts
    9·2 answers
  • What is the role of a cytoplasm​
    14·2 answers
  • Hubble's expansion law states _____.
    11·1 answer
  • Como se llama el ovulo fecundado
    13·1 answer
  • Animals adapted for surviving waves, as well as sudden changes in water level and temperature, would be found in the
    15·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!