I need help asap

Biology

2 answers:

pantera1 [17]2 years ago

4 0

Answer:

its A. only one parent and results in offspring that are identical to the parent.

Explanation:

loris [4]2 years ago

3 0

Answer:

A. only one parent and results in offspring that are identical to the parent.

Explanation:

Asexual reproduction creates an identical copy of the parent typically, in which the genes are copied directly, and the body parts are cloned. There may only be variations depending on the influences of the outside nature, but typically they are identical to the parent.

You might be interested in

How can water intake affect the volume and concentration of urine?

Alchen [17]

More water means more pee (theoretically). Pee is actually just garbage materials from the body (toxins). These color the urine. The more you drink, the more you have to pee and just pee clean because all toxins are out, or you have more water to take out the toxins, having less of it per let's say 0.5 l

3 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

2 years ago

Which area is studied by biologists

Novosadov [1.4K]

Biology is the study of life so a Biologist would study biology: the study of life and living things.

3 0

2 years ago

What are cells that express the same genes? A. The same B. Differentiated C. Mutated D. Not living

goblinko [34]

The answer would be A

6 0

2 years ago

Read 2 more answers

Cane toads are highly successful as an invasive species in Australia because there is only one species that is belivied to be ab

Artist 52 [7]

Are you asking what their predators are? As adults, the Australian meat ants can eat them. As tadpoles, they are eaten by camen, catfish, cat-eyed snakes.

4 0

2 years ago