1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alona [7]
3 years ago
9

In gymnosperms, pollination can occur by _____.

Biology
2 answers:
gladu [14]3 years ago
6 0
The wind makes pollination possible for gymnosperms. In gymnosperms ovaries are absent and the gametophytes of these plants are present on cones rather than flowers. Unlike angiosperms that get pollinated with animal interference, wind plays a crucial role in gymnosperm pollination. 
8090 [49]3 years ago
4 0

Answer:

wind

bees

Explanation:

You might be interested in
<img src="https://tex.z-dn.net/?f=Write%5C%3Ba%5C%3Bstory%5C%3Babout%5C%3Byour%5C%3Bbest%5C%3Bfishing%5C%3Btrip%21%5C%5C%5C%5C50
bearhunter [10]

Answer:

When I first read this question, all I could think about was the capsized fishing charter called, “the Erik”. The inept captain and crew of this boat caused the death of four passengers while three others remain missing. This disaster occurred back in 2011. I knew two of the passengers. One was recovered in 2013. The other is still listed as missing. However, this question concerns the “best story”. So, I’ll give you the accounts of my own experience. Back in 2013, my group of long-range fishing friends had chartered our annual 8-day trip out of Point Loma, San Diego. We had always chartered the same boat; the Shogun. At our traditional dinner the night before boarding, I remember the most notable topic being discussed was the remnants of Hurricane Ingrid. Ingrid had caused high winds and seas in the area where we wanted to fish.

5 0
3 years ago
Acording to erikson what is the first stage of psychosocial development?
Lilit [14]

Answer:

The answer would be trust .vs. mistrust

Explanation:

This is the first stage

Mark as branliest please :)

7 0
3 years ago
_________ of animals reduces the level of circulating reproductive hormones leading to increased longevity, typically due to red
Lerok [7]
<span>Sterilization of animals reduces the level of circulating reproductive hormones leading to increased longevity, typically due to reduce cancer mortality. The primary aim of animal sterilization is avoiding overpopulation, but this increased longevity could be an added benefit for an individual animal.</span>
8 0
3 years ago
Use kepler's third law to find the collapse time, assuming the star has the same mass as the sun.
kap26 [50]
Thank you for posting your question here at brainly. Below is the solution for the above problem. I hope it helps. 

period of orbit at 26000 AU 
<span>P = a^(3/2) </span>
<span>= (26000)^(3/2) = 4,192,374 years (Earth)</span>
6 0
2 years ago
What is the approximate carrying capacity of the
RoseWind [281]

Answer:

Explanation:

1) 250 indivuals

2) Year 3

3) 4 years

Quick answer :

250, 3, 4

(you can find this on brainly) link:  brainly.com/question/17375720

(im 13 so heck)

6 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Roan coat color in cattle develops through incomplete dominance of the gene for red color and its allele for white. what crossin
    7·1 answer
  • One way that mining for mineral resources damages land is by?
    9·2 answers
  • What kind of effect can a chromosomal change can have on an organism?
    13·1 answer
  • Which macromineral plays a role in energy production through its role in the breakdown of all three energy sources (carbohydrate
    9·2 answers
  • The hearing receptors are most closely associated with the
    8·1 answer
  • A particular diploid plant species has 48 chromosomes, or two sets. A mutation occurs and gametes with 48 chromosomes are produc
    8·1 answer
  • CLICK HERE PLEASE HELP
    5·2 answers
  • 1. Fill in the blanks
    10·1 answer
  • What do economists call the inverse relationship between price and quantity demanded?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!