1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

How many moles are in 6.02 x 1023 particles of Carbon dioxide? ​

Chemistry
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

There is one mole in 6.02*10^23 particles of anything ( also CO2)

You might be interested in
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
How is Carbon obtained and how is it separated from other substances nearby?​
irinina [24]

Carbon products are obtained by heating coal (to give coke), natural gas (to give blacks), or carbonaceous material of vegetable or animal origin, such as wood or bone (to give charcoal), at elevated temperatures in the presence of insufficient oxygen to allow combustion.

4 0
3 years ago
Read 2 more answers
Which statement(s) is/are TRUE about covalent bonds?
tresset_1 [31]

Answer:

1. Covalent bonds can form between two nonmetal atoms.

2. Covalent bonds can form between atoms of the same element.

3. Covalent bonds can form between atoms of different elements.

Explanation:

I hope this helps u! :D



Explanation:

3 0
3 years ago
Calculate the pH for the following 1.0M weak acid solutions:a. HCOOH Ka = 1.8 x 10-4 [
diamong [38]

Answer: pH=2.38

Explanation:

To calculate the pH, let's first write out the equation. Then, we will make an ICE chart. The I in ICE is initial quantity. In this case, it is the initial concentration. The C in ICE is change in each quantity. The E is equilibrium.

            HCOOH ⇄ H⁺ + HCOO⁻

I               1.0M          0          0

C              -x            +x        +x

E            1.0-x            x          x

<u>For the steps below, refer to the ICE chart above.</u>

1. Since we were given the initial of HCOOH, we can fill this into the chart.

2. Since we were not given the initial for H⁺ and HCOO⁻, we will put 0 in their place.

3. For the change, we need to add concentration to the products to make the reaction reach equilibrium. We would add on the products and subtract from the reactants to equalize the reaction. Since we don't know how much the change in, we can use variable x.

4. We were given the Kₐ of the solution. We know K_{a} =\frac{product}{reactant}=\frac{[H^+][HCOO^-]}{[HCOOH]}.

5. The problem states that the Kₐ=1.8×10⁻⁴. All we have to so is to plug it in and to solve for x.

1.8*10^-^4 =\frac{x^2}{0.1-x}

6. Once we plug this into the quadratic equation, we get x=0.00415.

7. The equilibrium concentration of [H⁺]=0.00415. pH is -log(H⁺).

-log(0.00415)=2.38

Our pH for the weak acid solution is 2.38.

8 0
3 years ago
Which of the following is NOT a true statement about liquids?
Nookie1986 [14]

Answer:

4

Explanation:

1 is correct

Liquids have no definite shape as they take up the shape of the container. Thus, we can say a liquid has no shape of its own but rather has the shape of the container in which it is filled.

2 is correct

When the atmospheric temperature is increased, it also will increase the boiling point of the liquid

3 is correct

This is an extension of the statement 2. While we decrease the atmospheric pressure, we are also decreasing the boiling point

4 is incorrect

A liquid have a definite volume. When we say a volume is definite, it means the volume is fixed and does not change. The volume of liquids is definite for a particular mass of the liquid and does not change

8 0
3 years ago
Other questions:
  • Calculate the pH of a 2.0 M H2SO4 solution.
    7·2 answers
  • Which of the following is an input for cellular respiration? a. CO2 b. H2O c. sunlight d. O2 Please select the best answer from
    10·2 answers
  • When exposed to very high temperature metals like iron can be turned into fluids that flow and can be poured into molds what hap
    8·1 answer
  • Which of the following did Democritus NOT think about atoms
    13·1 answer
  • Now starting with lithium, look at its electron configuration. Then look at all eight elements in the second period from lithium
    9·1 answer
  • How many atoms make up a diatomic molecule?
    7·1 answer
  • The incrasing order (lowest first) for the values of e/m for electron, proton,neutron and alpha particle is
    7·1 answer
  • GIVING BRAINLIST ASAP
    13·1 answer
  • Distinguish<br>between<br>matter<br>and a substance​
    10·1 answer
  • DESCRIBE THE FINAL TEMPERATURE AFTER DIFFUSION
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!