1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
2 years ago
12

Charles Darwin, Charles Lyell and Alfred Russell Wallace all contributed to the theory of

Biology
1 answer:
sdas [7]2 years ago
7 0
It is - Many scientific observations, related to biogeography and comparative anatomy were made, documented, and shared.
You might be interested in
3. Describe the difference between sexual and asexual reproduction. Give at least one example organism for each type.
Salsk061 [2.6K]

Answer:

Since sexual reproduction requires two individuals, it allows intermingling of genes which is beneficial for the individuals as well as the entire species. The organisms produced by asexual reproduction are genetically identical to each other. ( I hope it helps )

8 0
2 years ago
Read 2 more answers
Which nonspecific defense mechanism increases the resistance of cells to viral infection and slows the spread of disease?​
satela [25.4K]

Answer:

Which nonspecific defense mechanism increases the resistance of cells to viral infection and slows the spread of disease?​

the nonspecific defense mechanism that increases the resistance of cells to viral infection and slows the spread of disease is called phagocytic barrier

Explanation:

Phagocytic barrier helps to attack any foreign materials that enteiers the body system sych as bacteria, viruses among others.

5 0
3 years ago
Moth populations changed from mostly light colored to mostly dark colored in the 1800's. This relates to _____.
Goryan [66]

The answer would be C) microevolution cause

macroevolution is over a long period of time while micrevulotion is over a small period of time and happends change in species

Nioce pfp and hope u have a good day

8 0
3 years ago
At which phase are centrioles beginning to move apart in animal cells?
nirvana33 [79]
Prophase is the answer 
6 0
3 years ago
A 55-year-old female with right hydronephrosis presents for a cystourethroscopy with a retrograde pyelogram. what is the correct
laiz [17]
I believe that the correct diagnosis code is N13.30.
Diagnostic coding is the translation of written descriptions of diseases, illnesses and injuries into codes from a particular classification. These codes are used as part of the clinical coding process alongside intervention codes. N13.30 is a billable ICD code used to specify a diagnosis of unspecified hydronephrosis. 
7 0
3 years ago
Other questions:
  • In which class of organic molecules do starch, glycogen and cellulose belong?
    9·1 answer
  • Why can we sometimes hear noises in the stomach during digestion???
    14·1 answer
  • How do plants obtain nitrogen?
    15·1 answer
  • 4. Describe the structure and function of the lymphatic system.
    5·1 answer
  • True regarding sexual reproduction as a method of producing offspring
    6·1 answer
  • Female reproductive cells orneggs are produced by which structure in a flowering plant
    9·1 answer
  • In an experiment, you create two groups of liposomes in a solution containing 0.1 M NaCl—one made from red blood cell membranes
    14·1 answer
  • How can scientists investigate the impact of limiting factors on a population?
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Name three functions of the hormone epinephrine<br>​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!