1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alchen [17]
3 years ago
14

Binary fission is a process through which

Biology
2 answers:
Elza [17]3 years ago
8 0
Im not positive but I think it's b or c
Volgvan3 years ago
7 0

The correct answer is D.cellular DNA is cut in half.

You might be interested in
What pollutant forms when automobile emissions react with oxygen gas and ultraviolet light?
borishaifa [10]
Ozone is the pollutant that forms when automobile emissions react with oxygen gas and ultraviolet light.
6 0
3 years ago
The following is a growth curve of bacteria. What type of growth curve is pictured? A) linear growth B) logistic growth C) expon
garik1379 [7]

Answer:

C) exponential growth​

7 0
3 years ago
Question 1
Black_prince [1.1K]
The answer for first question is:

November, Candidates, City, Council.

The answer for the second question is:

Louis,Bleriot,France,English,Channel.
5 0
3 years ago
Read 2 more answers
SI units are the modern fo of the
Ugo [173]

Answer:

The International System of Units (SI) is system of units of measurements that is widely used all over the world. This modern form of the Metric system is based around the number 10 for convenience. A set unit of prefixes have been established and are known as the SI prefixes or the metric prefixes (or units).

7 0
4 years ago
A fox is a type of mammal that is related to dogs. How does a fox most likely respond to hot air temperatures in a way that ecto
koban [17]

Answer:

number 2 my guy

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • which of the following provides the best analogy for an electron in an atomic orbital? a. a bee moving from flower to flower in
    11·1 answer
  • How much does our brain shrink by 70?
    10·1 answer
  • Can someone help me ASAP on question 12!!
    9·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • most rivers curve or mender. water travels more slowly on the curve and more quickly on the inside of the curve which statement
    5·1 answer
  • The above picture represents the different stages a cell goes through in its "lifetime." Specific genes within the DNA, called i
    7·2 answers
  • Match the enzymes with the molecules they help break down<br> a. Amylase<br> b. Pepsin<br> c. Lipase
    9·1 answer
  • The development of nuclear power has provided electricity for less money, but at a cost. What may be considered a "cost" of nucl
    12·1 answer
  • Within a species, a number of characteristics remain the same from one generation to the next. This is because ____________.
    6·1 answer
  • Which kind of investigations never include a hypothesis?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!