1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lisa [10]
2 years ago
10

A picture shows a field partially covered with corn plants. The field has been flooded after heavy rain. The water is a milky br

own color.
A city’s water supply sits between several farms. The image shows one of the farms after a rainstorm.

What would you suggest the city leaders do to prevent water pollution? Choose the two correct answers.

A.
Ask the farmers to move the city’s water supply.

B.
Ask the farmers to plant more crops.

C.
Ask the farmers to stop spraying chemicals on their crops.

D.
Ask the farmers not to plant their crops so close together.
Biology
2 answers:
goldfiish [28.3K]2 years ago
8 0
I believe the answer can be C, correct me if i’m wrong
yulyashka [42]2 years ago
6 0

Answer:

The answer is B and C

You might be interested in
Atoms have particulars with different charges, the _______ has a negative charge.
slava [35]

Answer:

electrons

Explanation:

Protons=positive

electrons=negative

neutrons=neutral

8 0
3 years ago
Read 2 more answers
Paul is trying to obtain new insurance, but he fears he’ll be denied due to his cancer diagnosis and ongoing treatment. What leg
Thepotemich [5.8K]
Pre existing conditions law
5 0
2 years ago
What does a number in front of a molecular formula stand for???????
Harrizon [31]

Explanation:

The small number behind each element symbol designates the number of atoms of each element in a chemical formula. If there is no number, it is assumed there is only one of those elements. A large number designates how many units there are of that compound.

4 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What role so decomposers play in the nitrogen cycle
Harman [31]

Decomposers also break down the bodies of dead organisms resulting in nitrogen being returned to the soil as ammonia. In some conditions denitrifying bacteria in the soil break down nitrates and return nitrogen to the air.

mark brainliest   :)

hope this helped

3 0
3 years ago
Read 2 more answers
Other questions:
  • A section of a chromosome that determines the structure of a single protein or part one, thereby influencing a particular heredi
    10·1 answer
  • Classify these substances as acidic, basic, or neutral: vinegar, baking soda, tomato juice, sugar
    7·1 answer
  • Which factor when doubled would produce the greatest change in the centripetal force?
    11·1 answer
  • Injury, disease, medical conditions and even the aging process can impact the body's ability to communicate. give three examples
    11·1 answer
  • Igneouse instructions injected bettwen horizon layers are what
    15·1 answer
  • These are structures which are similar in different organisms because they evolved in a similar environment, yet do not have a c
    9·2 answers
  • How does DNA make you look like you do?
    14·1 answer
  • What people think about vaccine​
    14·1 answer
  • 5. Which of the following is the best organism to have in your compost pile?
    14·1 answer
  • What determines the order of elements in today's periodic table??
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!