We don’t know cuz u don’t have any of the answers
Small, highly concentrated cell organelles that produce proteins are called <span>ribosomes. Ribosomes can be free-floating or attached to endoplasmic reticulum.</span>
Answer: Experiment.
Explanation:
Suppose that we have two related variables, A (independent) and B (dependent)
We could design an experiment where we can manipulate the value of A at will, and we also can observe how the variable B changes.
This is called an experiment, where the objective is to see how the variable B is related to the variable A, and then try to make a model that explains this relationship.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
