1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
8

Why do scientists make a hypothesis before an experiment

Biology
1 answer:
Ugo [173]3 years ago
5 0

Answer:

Scientists make a hypothesis before an experiment so the can make an educated guess of the outcome before they get one.

Explanation:

The hypothesis is important because it allows scientists to make predictions about the upcomming experiment and then analyze the data after the experiment.

You might be interested in
Andrew is describing the water cycle in three steps, as shown in this simple model. Which statement belongs in the third region?
stira [4]
A. Water falls from the atmosphere as rain, ice, or snow
4 0
3 years ago
Read 2 more answers
What does the phrase "Aspiring designers mean? HELP PLZ!!​
anzhelika [568]

To have a great ambition or ultimate goal; desire strongly

8 0
3 years ago
How can competition lead to evolution?
Alex17521 [72]

Answer:

The animals adapt to survive.

Explanation:

If a giraffe can't reach the food that another one can, that giraffe will die and the longer necked one wll survive. Adaptations over time cause evolution. The fittest will survive. (Darwinism)

5 0
3 years ago
Can someone help me please
kozerog [31]
<h2><u><em>Answer:</em></u></h2>

the correct options are:

  • Earth  is an inner planet
  • Earth is denser than Jupiter
  • Jupiter is mostly made of Gas
  • Jupiter revolves faster than Earth

<h2><em>HAVE A NICE TIME:)</em></h2>

<em>STAY SAFE:)</em>

4 0
2 years ago
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
Other questions:
  • In the fictional hobbit, there exist 5 alleles of the foot size gene:
    13·1 answer
  • The resource speaks of the atmosphere as if it were living. In the sense that as the earth's surface is heated by the light from
    12·1 answer
  • What will result in a decrease of gfr?
    10·1 answer
  • The chemical bonds in peptidoglycan can be hydrolyed by the enzyme _____, found in tears and saliva.
    15·1 answer
  • Sea anemones are predatory invertebrates with stinging tentacles that can paralyze many sea animals. The clownfish is immune to
    6·2 answers
  • Why is it important for scientists to develop a way to grow tissues that have a built-in system to supply blood
    13·2 answers
  • What three body systems help maintain body temperature?
    7·1 answer
  • Describe how proteins can speed up chemical reactions and how they can help transport oxygen throughout the body.
    13·1 answer
  • If the volcanic ash from an eruption extends to 2.5 miles into the atmosphere, how many kilometers does this represent?
    9·2 answers
  • Nutrients are brought to spongy bone through which mechanism? (2 points)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!