1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
2 years ago
11

Choose all the right answers.

Biology
1 answer:
MA_775_DIABLO [31]2 years ago
6 0
Vascular tissue is a type of plant tissue
You might be interested in
Veins have valves which allow blood to flow only in one direction. Arteries do not have valves. Yet the blood flows in one direc
Valentin [98]

Answer:

Arteries carry oxygenated blood away from the heart. Veins carry the blood back to the heart. Veins contain valves that ensure blood flows in only one direction. Arteries don’t require valves because pressure from the heart is so strong that blood is only able to flow in one direction.

Explanation:

8 0
3 years ago
Read 2 more answers
Glycolysis is an example of a metabolic pathway that is utilized by all human body tissues. Other pathways are much more promine
AnnyKZ [126]

Answer:

1. Liver

2. Liver and Kidneys

3. Mitochondria

4. Lumen of the small intestines

5. Liver

Explanation:

1. Glucose is phosphorylated into glucose-6-phosphate which is the first step of both glycogen synthesis and glycolysis, this process occurs in the liver

2.   Glucose 6-phosphate is a product of a process named gluconeogenesis which occurs in the liver it serves as a substrate for glucose-6-phosphatase in the liver.

3. Creatinine kinase is an enzyme that catalyzes the phosphorylation of creatine. In regeneration process of ATP, creatine phosphate transfers a high-energy phosphate to ADP which produces ATP and creatine

4. Initially lipase digestion lipase digestion happens in the small intestine where the bile salts reduce the surface tension of the fat droplets allowing the lipases to attack the triglyceride molecules. These molecules are taken up into the epithelial cells that line the intestinal wall, where they are resynthesized into triglyceride

5. The job of the liver is to produce ketone bodies. If the liver had this enzyme, the ketone bodies it produces would be immediately broken down by the liver before they are released, thereofore, no release of ketone bodies into the bloodstream

7 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
what causes the Aurora Borealis? movement or charged particles in the outer core? Circulation of Van Allen belts around the plan
Nonamiya [84]

charged particles in the outer core

7 0
3 years ago
A patient comes to you with a "PUS" sample and asks you to isolate &amp; identify the Staphylococcus aureus form this sample the
Irina-Kira [14]

Answer: Staphylococcus aureus can be isolated from the pus sample through the following steps:

--> Step 1: Describe the appearance of the specimen

--> Step 2: Examine the specimen microscopically

--> Step 3: Culture and report your observations.

--> Step 4: Biochemical testing

Explanation: Staphylococcus aureus are gram positive cocci bacteria that can be isolated from pus samples.Pus samples, which may come from wounds, abscess, burns or sinuses, are the type of samples which do not contain microorganisms and should not contain contaminants providing an aseptic collection technique and sterile container are used.

Staphylococcus aureus can be isolated from the pus sample through the following steps:

--> Step 1: White, yellow, brown, red, or black granules of varying size, shape, and consistency may be found in pus draining from

sinuses while describing the appearance of the pus sample.

--> Step 2: Here the specimen is examined microscopically after being stained with a staining technique called Gram staining. This step is done before culture to know the type of medium to use after gram positive cocci is microscopically seen.

--> Step 3: there are different cultures media that can be used to inoculate and culture a pus specimen. Since we are to isolate staphylococcus aureus, a selective and differential media known as Mannitol salt agar (MSA) is used. The presence of yellow colonies with yellow zone after incubation at 37°C indicate the presence of Staphylococcus aureus or species. There for the last confirmation test known as biochemical test is done.

--> Biochemical test: This is a chemical test that is done to identify a particular bacteria. For staphylococcus aureus, COAGULASE test is used to identify staphylococcus aureus which produces COAGULASE enzyme. A positive COAGULASE test is an indication of the presence of staphylococcus aureus as the bacterium isolate of the specimen.

7 0
3 years ago
Other questions:
  • scientists discovered bacteria inside one of the returned pieces of Surveyor 3 What are some possible explanations for this surp
    13·1 answer
  • Which has more entropy: popcorn kernels or the resulting popcorn?
    13·1 answer
  • Some peeled pieces of apple were placed in purified water and some in heavily concentrated salt water. The cells in the apple pi
    13·2 answers
  • Explain how deforestation can permanently increase an area’s risk of flooding.
    6·1 answer
  • What is emigration ​
    10·2 answers
  • Why do you think William Morgan invented the sport mintonette? what do you think is the purpose?​
    10·1 answer
  • What is the equation on how to produce energy?
    14·1 answer
  • Imagine you do fingerprinting in a forensics lab. you obtain six samples from a crime scene
    9·2 answers
  • Determine if each of the following statements is a well-written, testable hypothesis. Explain your answers.
    6·1 answer
  • Calculate the percentage ionization in these amino acid side chains at the ph values specified:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!