1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
crimeas [40]
3 years ago
9

How would you describe attraction? How would you describe repulsion?

Biology
2 answers:
ANEK [815]3 years ago
4 0

Answer:

Attraction: is a feature of some sort that draws two things together. For example, opposite sides of magnets <em>attract</em> each other,

Repulsion: is the opposite of attraction. Instead of bringing things together, it pushes them apart.

Explanation:

Vesnalui [34]3 years ago
4 0

Answer:

it is a property of managet that with same pole repale each other and opposite pole attract each other

You might be interested in
What occurs if a t cell binds to an antigen and the t cell does not receive a co-stimulatory signal?
tresset_1 [31]
The correct answer is that "the T cell enters a state of anergy".

The activation of T cells requires two signals: (1) antigen specific signal presented by an antigen presenting cell (either a macrophage or a dendritic cell) that activates t cell receptors and (2) co-stimulatory signals that is not antigen specific but rather found in the plasma membrane of the antigen presenting cell (i.e. CD28). In the absence of a co-stimulatory signal, the t cell will enter a state of anergy or the inability to produce an immune response toward an offending antigen.
4 0
3 years ago
Which of the following diseases is always caused by a virus?
mrs_skeptik [129]

Answer:

Cancer

Explanation

3 0
3 years ago
Read 2 more answers
How do basaltic rocks differ from granitic rocks?
DanielleElmas [232]

Answer:

ddasd

Explanation:

5 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
during which stage of the human life cycle does the body go through a series of changes to prepare for sexual reproduction?
Vaselesa [24]

Answer:

Puberty

Explanation:

5 0
3 years ago
Other questions:
  • The largest taxon is the _____ and the smallest is _____.
    15·1 answer
  • During which process does one bacterium inject its DNA into another
    9·2 answers
  • Hypothermia is a condition caused by exercising in extreme heat.
    15·2 answers
  • Which cell organelle provides instructions to the Golgi apparatus on where the substances should be delivered?
    8·1 answer
  • Which part of the brain connects the right and left hemispheres allowing communication between the two?
    12·1 answer
  • What process changed the genetics of some rabbits over many generations to give them white or spotted fur and to make them frien
    5·1 answer
  • Which of the statements regarding the cell cycle is true? Group of answer choices It is regulated by cyclins and CDKs. Different
    11·1 answer
  • The plasma membrane represents an energetic barrier to the free diffusion of ions from the extracellular space into the cytoplas
    7·1 answer
  • Some cells, such as human nerve and muscle cells contain many more mitochondria than do cells such as skin cells why do some cel
    6·1 answer
  • Help on number 10 plzzz​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!