1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lukranit [14]
3 years ago
7

7. As the Moon orbits the Earth, the waters of the Earth that are closest to the

Biology
1 answer:
spin [16.1K]3 years ago
5 0

Answer:

B. Bulge Outwards

the bulge will create a high tide.

You might be interested in
Q: A: Which of these best describes what occurs during cytokinesis?
Nitella [24]
The correct answer is the cytoplasm is divides between the two new daughter cells Cytokinesis is the final stage of the cell cycle in which cytoplasm, the material within the living cell, divides into two daughter cells.
5 0
3 years ago
Which of the following explains why birds are unable to store fat?
sertanlavr [38]
Have a primitive digestive system
3 0
3 years ago
Which organisms would normally be the least numerous in this community?
grandymaker [24]
B. Krill
I hope this will help you that is the correct answer
 <span />
4 0
3 years ago
How does the structure of water contribute to its unique properties
frutty [35]

So basically water is a polar molicule. So when it comes to the structure, water is able to form many hydrogen bonds and the way the atoms are able to bond together adds to the water's special properties.

8 0
3 years ago
What are the three possible outcomes for species when rapid environmental changes occur
Montano1993 [528]

Rapid environmental changes can cause:

1) Species can become vulnerable to extinction.

2) A decrease or increase of populations.

3) Diversity of species.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which division has a single preganglionic neurons with many axon collaterals that forms 20 or more synapses with postganglionic
    14·1 answer
  • Can a person with blood type A successfully receive a transfusion from a person who has type O? Why or why not?
    10·1 answer
  • Which of the following features is common to both DNA replication and transcription?
    11·1 answer
  • What is earths crust?
    12·2 answers
  • Which of the following occurs during pollination in angiosperms?
    9·2 answers
  • True or false: Quartz will scratch minerals in the list, numbered 1 through 6.
    9·1 answer
  • Translation of the DNA sequence AAGCTGGGA would result in
    5·1 answer
  • What would be the magnification if you were using a 40x objective
    6·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Can someone please help me
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!