1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alekssandra [29.7K]
3 years ago
9

Scientists can learn all of the following by studying fossils EXCEPT:

Biology
2 answers:
Sveta_85 [38]3 years ago
7 0

Answer:

How the Erath's surface has changed over time

Shtirlitz [24]3 years ago
7 0

Answer: How the surrounding rock layers have changed over time

Explanation:

I’m taking a minion quiz in science class and I submitted it and we’ll that’s the correct answer

You might be interested in
How a forest ecosystem would change if no sunlight were available to it
bezimeni [28]

Explanation:

If there is no sunlight the plants will die. Then because of dead plants the herbivores will die and so on. the food chain will be very disrupted.

6 0
3 years ago
Which of the following statements describes how a balance obtains a measurement?
Tanya [424]

Answer:

sorry if wrong

Explanation:

b I think sorry if wrong

8 0
3 years ago
Need help ASAP please!!!
hammer [34]
Be careful bro coronavirus is coming, get far away from Chinese people
6 0
4 years ago
Read 2 more answers
A man of unknown genotype has type B blood, his wife has type A blood (also unknown genotype). List ALL the blood types possible
shtirl [24]

Answer:

AB, aB, Ab

Explanation:

Man has blood type B so could be BB (homozygous dominant) or could be Bb (heterozygous)

Woman has blood type A, so she could be AA (heterozygous dominant) or Aa (heterozygous)

Now, we need to make a separate cross for woman with AA, man with BB and we get children of all AB

Then we can make another cross for genotypes Aa and BB, and we get AB and aB

We can continue this for AA,Bb and for Aa,Bb

5 0
3 years ago
The United States has the most reserves of which fossil fuel?
LiRa [457]
The answer is "A.Coal".
5 0
4 years ago
Read 2 more answers
Other questions:
  • Pls i need help??!!!<br> write a sentence contrast evaporation and condensation.
    14·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • How can dna sequencing identify disease pathogens such as viruses?
    10·1 answer
  • 1.) the field names in the data base are also known as __________.
    11·1 answer
  • Reciprocal altruism can be best explained with a model proposed by Robert Trivers in 1971. Trivers hypothesized that if one indi
    15·1 answer
  • Determine the correct order for the transmission of a signal through the nervous system.
    7·2 answers
  • Describe the immediate effect of the neurotoxin on the number of action potentials in a postsynaptic neuron. Predict whether the
    11·1 answer
  • Can someone please help me!!!????
    5·1 answer
  • HIV, the virus causes AIDS, depends on an enzyme called reverse transcriptase to multiply. Reverse transcriptase reads a molecul
    12·1 answer
  • Explain how carbon moves from one Earth System sphere to another
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!