Carcinogens -- cancer- causing substances-- in each cigarette.
Some man-made fibres, too, are derived from naturally occurring polymers. For instance, rayon and acetate, two of the first man-made fibres ever to be produced, are made of the same cellulose polymers that make up cotton, hemp, flax, and the structural fibres of wood.
I think the second and fourth ones are it.
Fish needs energy to breath. When the concentration of oxygen in the water is reduced as a result of one factor or the other, it leads to the death of the fishes that are living in that pond. ... The amount of oxygen needed in a pond usually increase as the temperature of the water increases.
I hope this helps.
I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.
<span> ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA
</span>
mRNA
UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU