1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina [24]
3 years ago
12

Which is the best characteristic that distinguishes the kingdom Archaebacteria from the kingdom Eubacteria? Ocell wall structure

O body type nutrition source presence of a nucleus​
Biology
2 answers:
andreyandreev [35.5K]3 years ago
8 0

Answer: i got cell wall structure!

Explanation: good luck!!

Nikolay [14]3 years ago
7 0

Answer:

cell wall structure.

Explanation:

its correct

You might be interested in
List 4 chordate characteristics.
jek_recluse [69]

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

4 0
3 years ago
What is an example of static electricity?
notsponge [240]
When you rub a ballon in your hair.
7 0
4 years ago
Read 2 more answers
Fused digits (F) is a dominant trait. A pedigree for one family is shown on the right, with affected individuals marked by shade
Naddik [55]

Answer: Ff                             Fused digits (F) is a dominant trait. A pedigree for one family is shown on the right, with affected individuals marked by shaded symbols. Use this to answer Question 10.

Question 10

What is the genotype of Individual II-4?

A: FF

B: Ff

C: ff

3 0
3 years ago
Are mitochondria found in both plant and animal cells?
olya-2409 [2.1K]
Yes the mitochondria is essential for both plant cells and animals cuz it’s the powerhouse of the cell
3 0
3 years ago
The condition in which the individual has more than two elevated areas on the chest or abdomen with areola and nipple is called
Dimas [21]
11111111111111111111111111111111111111111111111111
5 0
3 years ago
Other questions:
  • The giant short-faced bear disappeared completely from North America about 12 million years ago due to competition from smaller
    15·2 answers
  • Why do the lungs appear collapsed in the fetus
    15·1 answer
  • ABC
    8·1 answer
  • The question i really wanna know is how smart is a fish???
    7·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Haploid cell with half number of chromosomes as parent cell. Result of meiosis - sperm (male) and egg (female)
    7·1 answer
  • The enzyme lactase get used up in the reaction<br><br> true/false
    14·2 answers
  • PLEASE HELP, I NEED THIS TO PASS xx,
    5·1 answer
  • I need help. You have to develop your own beakers and then explain.
    10·1 answer
  • During , the cell's nucleus duplicates itself and the cell divides. During , a specialized form of cell division occurs to form
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!