Answer:
Las unidades de Mendel se conocen ahora como GENES
Explanation:
Durante sus experimentos, Mendel demostró que las características de las plantas de guisante (por ejemplo color de la flor, color de la semilla, forma de la semilla, altura de la planta, etcétera) eran heredadas, y denominó "elementos" a las unidades portadoras de dichas características. Es decir que cada elemento o unidad discreta, era el responsable de que la planta exprese una u otra característica. Estableció que estos elementos se redistribuían independientemente uno de otro, generación tras generación. Con el paso del tiempo y el avance de las investigaciones, estas unidades o elementos fueron denominados <em>Genes</em>.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The answer would be you bounce a basketball
All carbohydrates, including sugar, therefore contain the same three elements: carbon, hydrogen<span> and </span>oxygen<span>. Different arrangements of these elements </span>form<span> single units to make different types of carbohydrates. Glucose, for instance, is a single-unit carb with six </span>carbon atoms<span>, 12 </span>hydrogen<span> atoms and six </span>oxygen atoms<span>. hope this helps . </span>
