1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
2 years ago
14

How does actin and myosin work together to help you lift an object?

Biology
1 answer:
Scilla [17]2 years ago
6 0

Answer:

Muscle contraction thus results from an interaction between the actin and myosin filaments that generates their movement relative to one another.

You might be interested in
If one parent has Type A blood and the other has type B, but all four types are represented among the offspring, what are the ge
Sholpan [36]

Answer:

heterozygous A father and heterozygous B mother

Explanation:

7 0
3 years ago
Plants make their own food using energy that comes from the
zubka84 [21]
Sun which produces sunlight
7 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
PLS HELP!!!
Tcecarenko [31]
B is the answer.

Hope this helps!
8 0
3 years ago
Read 2 more answers
20 POINTS
alex41 [277]
There’s you go :)

This is how you do it Genotypes - none ____________ Phenotypes - all

4 0
3 years ago
Read 2 more answers
Other questions:
  • Please help!
    15·2 answers
  • Can you artificially grow organs
    11·1 answer
  • The control and experimental groups are designed to be identical<br><br> True or false
    5·2 answers
  • An individual who has the genotype HbSHbA has the phenotype of:
    9·1 answer
  • What chromosomal disorder is illustrated in Figure 14–9?
    9·1 answer
  • Which of these organisms are the most closely related? Remember, the name of an organism is the form of Genus species.
    9·2 answers
  • The chromosomal mutation in the zygote can be traced back to which of the following? (4.3, 4.4)Immersive Reader
    15·1 answer
  • Witch of these is a characteristic of index fossils
    9·1 answer
  • Location X and Y are adjacent. Location X has a lower air pressure than Location Y. What will most likely happen?
    14·2 answers
  • Cross a person who does not have freckles and is heterozygous for dimples with a person who has
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!