1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
3 years ago
6

What is Nasal Cavity

Biology
1 answer:
Firdavs [7]3 years ago
4 0
The space inside the nose. The nasal cavity lies above the bone that forms the roof of the mouth and curves down at the back to join the throat. It is divided into two sections called nasal passages. Air moves through these passages during breathing.
You might be interested in
Please create an orginal enough answer!
Lostsunrise [7]

Answer:

If wolfs were absent from their environment the food they eat like rabbits for example would be overabundant and eat all the plants and not leave any food left for other animals that need it and those animals would die.

Explanation:

7 0
3 years ago
Professor is preparing a traditional Thanksgiving meal and decides to make some turkey soup. He uses part of the leftover turkey
Umnica [9.8K]

Answer:

Fat from the Turkey

Explanation:

It's from the turkey. The fat solidified and the layer is floating at the top.

5 0
2 years ago
How To complex volume by water displacement
lubasha [3.4K]
You divide it by two 
8 0
3 years ago
Which of the following properties describes a soil’s ability to supply nutrients?
ivanzaharov [21]
The correct answer is soul fertility. Soil fertility refers to the ability of soil to sustain agricultural plant growth, i.e. to provide plant habitat and result in sustained and consistent yields of high quality.[1] A fertile soil has the following properties:[2]

The ability to supply essential plant nutrients and water in adequate amounts and proportions for plant growth and reproduction; and
The absence of toxic substances which may inhibit plant growth.
6 0
3 years ago
What are the limitations of sending information using electromagnetic waves?
Shalnov [3]
Well, the range is more limited. Let's say if you tried listening to Denver radio all the way in Texas, you wouldn't be able to listen to it.

Another one is that other electromagnetic waves with similar frequencies can interfere with each other
6 0
3 years ago
Read 2 more answers
Other questions:
  • What are the two main ways that scientists learn about Earth's interior and what do these two things indicate?
    7·2 answers
  • A company in San Francisco uses petroleum products to make plastics. Arrange the sentences in the correct order to show how the
    6·2 answers
  • What technological advancement helped people learn about cells?
    11·1 answer
  • The term andropause, or male menopause, is sometimes used to refer to _____.
    12·1 answer
  • Contrast primary succession and secondary succession. Give an example of each.
    8·1 answer
  • Which of the following statements is true of meiosis? (4 points)
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • alfred hershey and martha chase designed an experiment to determine the chemical makeup of griffith's transforming principle. de
    7·1 answer
  • What might be the consequences of your choice politicial, economic and social
    10·1 answer
  • The frequency of a wave does not change as it passes from one medium to another.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!