2 years ago

Animals are made up of which type of cells?

Biology

2 answers:

zaharov [31]2 years ago

5 0

Answer:

dog

Explanation:

Irina-Kira [14]2 years ago

4 0

Animal cells are typical of the eukaryotic cell, so that's what they are made out of hope it helps

Explanation:

You might be interested in

BRAINLIEST

spayn [35]

Answer:

All the above

Explanation:

I'm not 100% sure this is accurate. Good Luck!

8 0

2 years ago

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

2 years ago

Early one spring, a group of bird-watchers counted 30 different species of birds in a tract of forest. In the early spring two y

Gemiola [76]

The forest shows a decrease in biodiversity

5 0

2 years ago

The burning of coal, a fossil fuel, produces water and carbon dioxide. How is this similar to cellular respiration?

Nimfa-mama [501]

Answer:Both release carbon into the atmosphere, but burning fossil fuels releases CO2 at a much greater amount.

Both cellular respiration and combustion require a core fuel for the process to happen at all.

8 0

3 years ago

Read 2 more answers

What’s of evidence must be together to support the idea that all living things are composed of cells

Ierofanga [76]

Answer:

living organisms are composed of cells.

Organelles cannot survive alone

cells multiply through division

Explanation:

8 0

3 years ago