Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>
Answer:
<em>The correct option is D) A species that does not normally live in an area.</em>
Explanation:
Non- native species can be described as a species which do not live in a particular habitat but are introduced into the habitat due to certain reasons or causes. The introduction of non-native species might badly affect the stability of an area. The non-native species might fight with the native species for resources like food, water, shelter etc. Sometimes, the introduction of non-native species is done so that the species can feed on any other species which is not beneficial for that environment.
Answer:
The individuals can also be classified on the basis of their psychology and happiness. The depressed individual remains unhappy and suffers from anxiety and enjoy the loneliness feeling.
The body dysmorphic disorder involves the situation in which individual is unable to move their body part. They are physically unfit but mentally be fit. The unhappy individual are physically fit but mentally and socially they are unfit.
Anions are negatively charged particles. The water molecule is a polar molecule, that means that, it is partly positive and partly negative. The oxygen atoms in the water molecules are more electronegative more than the hydrogen atoms and they draw the shared electron nearer to themselves than the hydrogen atoms; this make them to be slightly negatively charged while the hydrogen atom is slightly positively charged.
Therefore in solution, the anions would be attracted toward the hydrogen atom that is slightly positive while the cations will be attracted to oxygen atom that is slightly negative.
The answer is A, anti-fungal drugs.
According to the passage, "but if the problem persists, see a doctor who can prescribe anti-fungal drugs". In additional, at the beginning of the passage, it already stated that athlete's foot is caused by a fungus, so we can sure that the answer is A.
