Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
(B) Energy released from the chemical reaction is used to directly phosphorylate ADP.
(D) Energy released from the chemical reaction is used to directly reduce NAD+
Explanation:
phosphorylation is a addition of phosphoryl group to an organic compound.Substrate level phosphorylation is a process where there is ATP is produced from ADP by transferring a high energy phosphate group from phosphorylated metabolic compound.This process occurs in glycolysis and citric acid cycle.and this pathway is exergonic pathway
Answer: <span>A. gk, gK
</span>
The scientist doing a dihybrid crossing using <span>plants with a genotype ggKk. To make the Punnet square, you need to understand how the gamete divided. The square should be
K k
g gK gk
g gK gk
The possible gamete for gg-Kk would be
1. gK
2. gk
</span>
Im not sure but im guessing its B)
The modern era of flight lifted off in 1783 when two brothers demonstrated their invention, the hot air balloon, before a crowd of dignitaries in Annonay, France.