1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jarptica [38.1K]
3 years ago
11

So my teacher assigned us a volcano project and she is asking us what the frequency of our volcano is, I chose the volcano Mauna

Loa, and I’m in desperate need of what the frequency is of it! It’s due tomorrow and I need help!!
Biology
1 answer:
balandron [24]3 years ago
3 0

Ok I will help you I just gotta look it up real quick
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
charles darwin developed the theory that explains how new species develop based on evidence from many different kinds of scienti
mixer [17]
The scientists who provided this hypothesis had an idea that the species evolved in order to accommodate their needs on certain islands. For instance, an example is beak size of certain birds which Darwin thought that this was to eat certain foods.
3 0
2 years ago
Read 2 more answers
During photosynthesis, the energy from sunlight is used to split water molecules. What happens to the hydrogen ions that are spl
dalvyx [7]
They build up in the thylakoid, where they bond to each other to create ATP.

Not 100% about this but that's what i got.
8 0
2 years ago
1. Describe the differences between radiation, conduction, and convection.
kkurt [141]

1. Radiation - energy transmits through particles that ionize. Conduction - heat is transferred through a substance without moving the material. Convection - transfer of heat through movement.

2. Earth receives energy from the sun, which is transferred between Earth and its atmosphere.

3.<span>Wildland fires, dust storms, and volcanic activity. They release CO2, CH4, N20, and sulfur dioxide.</span>

4. Burning coal, releases carbon dioxide and other pollutants. Gasoline, releases air pollution. Factories, releases carbon dioxide, methane, and nitrous oxide.

4 0
3 years ago
Read 2 more answers
What occurs during a temperature inversion
kherson [118]
Cold air will underlie warmer air at higher altitudes. :^)
Hope this helps!
5 0
3 years ago
Other questions:
  • What are some factors that might cause changes in the population of grasshoppers?
    5·2 answers
  • A protective tissue that also secretes is ______________________ tissue.
    14·1 answer
  • Why did hurricane sandy dissipate after making landfall
    12·1 answer
  • What element has 81 protons in the nuclei of its atoms?
    13·1 answer
  • Individual
    10·1 answer
  • In which phase do sister chromatids line up in the middle of the cell, (in 'single-file', without a homologous partner)? Group o
    15·1 answer
  • What are glaciers? A glacier is a huge mass of ice that moves slowly over land.
    11·1 answer
  • What would happen to the life of a cell if there was no Golgi apparatus?​
    9·2 answers
  • Which of these is
    10·1 answer
  • Catabolism of food molecules involves ________. group of answer choices glycogenesis dehydration reactions synthesis reactions h
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!