1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jlenok [28]
3 years ago
6

What typically happens to a population if it exceeds it’s carrying capacity?

Biology
2 answers:
Ket [755]3 years ago
7 0

Answer:

D. birth rate will exceed death rate

defon3 years ago
5 0

Answer:

D

Explanation: Population will proceed to grow, until resources are used up, then population begins to decrease.

You might be interested in
Producers A.convert inorganic material into energy B. convert sunlight into energy C.produce identical offspring D. are found on
7nadin3 [17]
<span>B. convert sunlight into energy</span>
4 0
3 years ago
Read 2 more answers
What eats turkey vultures
VladimirAG [237]
Horned owls, red-tailed hawks and golden eagles
7 0
3 years ago
I need help with these two questions!!!
ANEK [815]
The answer to number 2 would be as the number of carbon carbon 2ble 2ble bonds increase, the melting point decreases
8 0
3 years ago
What is the cleanest burning fossil fuel?
Alexandra [31]
Natural gas (methane (CH4)) is the cleanest burning fuel<span>, emitting the smallest amount of carbon dioxide of all the </span>fossil fuels<span> (coal, oil and natural gas).</span>
7 0
3 years ago
Although ____ kills mosquitoes, it is harmful to the reproduction of many predatory birds.
liberstina [14]
I believe the correct answer is DDT.
It kills mosquitoes but thins the eggs of birds.
Hope this helps.
4 0
3 years ago
Read 2 more answers
Other questions:
  • <img src="https://tex.z-dn.net/?f=%28%20-%203%29%20%2B%20%28%20-%206%29%20%5Ctimes%20%28%20-%205%29%20%5Cdiv%202" id="TexFormula
    10·1 answer
  • Macrophages are white blood cells that roam the body searching for invading microbes. inside macrophage vacuoles these invaders
    12·1 answer
  • This is a __________ reaction and the product(s) is/are A) replacement; aluminum. B) decomposition; oxygen. C) synthesis; alumin
    12·2 answers
  • PLZ HELP WILL GINE BRAINLIST :(
    12·1 answer
  • Humus is made of tiny pieces of weathered parent material. true or false?
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Awnser or comment if you think i should do a face reveal
    10·2 answers
  • On the model of a carbon atom below, label the protons, neutrons, and electrons in your model. Summarize what you have drawn in
    8·2 answers
  • What organelles do plants have in their roots that helps them to sense gravity?
    14·1 answer
  • What is the rate at which the body expends energy for daily maintenance activities, like keeping the body alive and organ functi
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!