The generalization could the field biologist correctly make is that the pepper frog and bullfrog do not interbreed.
<h3>What do you mean by Habitat?</h3>
Habitat may be defined as a type of natural environment for which a particular species is best adapted due to natural selection.
In this graph, it is clearly demonstrated that the particular species undergo breeding at a specific period of time during a year. The species of pepper frog breed in the month of April, while the species of the bullfrog breed in the month of July.
Therefore, the generalization could the field biologist correctly make is that the pepper frog and bullfrog do not interbreed.
To learn more about Breeding seasons, refer to the link:
brainly.com/question/11683061
#SPJ1
The process of respiration produces energy for organisms by combining glucose with oxygen from the air. During cellular respiration, glucose and oxygen are changed into energy and carbon dioxide. Therefore, carbon dioxide is released into the atmosphere during the process of cellular respiration.
Hope this helped
Answer:
Breathing Is Automatic and Not Autonomic
Conscious factors can override or modify automatic functions of the respiratory control system for a limited period. For example, an individual can voluntarily speak, smell, hyperventilate, or hold their breath.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
Answer:
Double helix
Explanation:
that's the biology in humans
