1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PilotLPTM [1.2K]
2 years ago
8

There are varying levels of light in the ocean. Research and describe any one adaptation that helps ocean organisms to stay near

the sunlit surface.
Biology
1 answer:
Fantom [35]2 years ago
5 0

Answer:

sunlight entering the water may travel about 1,000 meters (3,280 feet) into the ocean under the right conditions, but there is rarely any significant light beyond 200 meters (656 feet). The ocean is divided into three zones based on depth and light level. The upper 200 meters (656 feet) of the ocean is called the euphotic, or "sunlight," zone.

Explanation:

hope this helps

You might be interested in
A type of frog is introduced to a new environment, and it has no predators there. What is likely to happen?
zlopas [31]
Answer:
It will overpopulate and harm

Explanation: without a predator the frog will most likely hurt the native animals and plants which isn’t good for the environment.
8 0
3 years ago
Read 2 more answers
If only one type of tree is planted in an abandoned field, the ecosystem will
Citrus2011 [14]
If only one type of tree is planted in an abandoned field, the ecosystem will contrail<span> little genetic variability. This is not a healthy way of planting. This can lead to the total destruction of the trees. I hope that this is the answer that you were looking for and the answer has actually come to your desired help.</span>
8 0
3 years ago
True or false <br> How an animal obtains food is part of its niche
svlad2 [7]

Answer:

False

Explanation:

A niche is making a living as a top carnivore.

5 0
3 years ago
1. What is the cuttlefish's main diet?
Vera_Pavlovna [14]

Answer: Their diet consists of small shrimp and crustaceans, including larvae. As they grow older, they graduate to fish, crabs, and other mollusks.

Explanation:

5 0
3 years ago
When NAD+ becomes NADH, it is being
ipn [44]

NAD+ accepts a hydrogen ion (H+) and two electrons (2e−), as it becomes reduced to NADH + H+. The NADH moves to the electron transport chain and donates a pair of electrons (becomes oxidized) to the first compound in the chain.

Explanation:

5 0
3 years ago
Other questions:
  • Which of the following increases genetic variation within a population and causes change
    7·2 answers
  • Leaves and dams are beneficial to farmlands because they
    14·1 answer
  • What cell organelle has a singled membrane structure?
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • At rest, a cell membrane is said to be ___________.
    9·1 answer
  • Identify the structures of skeletal muscle.
    9·1 answer
  • Why is it likely scientists will never find a rock old enough to confirm the earths actual age
    6·1 answer
  • What is the answer for “make ribosomes (RNA)
    6·1 answer
  • Like replication and transcription, translation is a process in which the information present within a nucleic acid template is
    11·1 answer
  • Help me please help ​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!