1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verizon [17]
3 years ago
6

Which group of organisms in the carbon cycle converts carbon into a form that is available to primary consumers?

Biology
2 answers:
Goryan [66]3 years ago
6 0
The producers convert <span>carbon into a form that is available to primary consumers.</span>
Semenov [28]3 years ago
4 0
Producers they serve as a food source for consumers
You might be interested in
Why is homeostasis important to the human body?
sergiy2304 [10]
Homeostasis is a tool that your body uses to keep things in balance. Such as your body temperature. Too hot, you start to sweat. (which cools you down as it evaporates) And when you're too cold, your body starts to shiver, effectively warming you up by making your body move rapidly.
8 0
3 years ago
Which Mimulus species would you categorize as mainly asexual reproducers? Why? A. M. rupestris and M. eastwoodiae; they put more
nekit [7.7K]

Answer: C. M. rupestris, M. eastwoodiae, and M. nelsonii; they put more energy into making rooted branches than they put into making nectar and seeds.

Explanation:

In asexual mode of reproduction the plant does not produce gametes. The plant reproduce through vegetative propagation or spore formation. The plant does not produce nectar as no flowers are produced to attract the pollinators.

In sexual mode of reproduction the plant will develop the gametes and flowers will produce the nectar to attract the pollinators.

Thus on the basis of above explaination, C is the correct option. As the plants will invest more energy in making roots which are the organs for vegetative propagation a process of asexual reproduction.

6 0
3 years ago
Which molecule (carbohydrate, lipid, protein) supplies more ATP one broken down?
erastova [34]
The number of ATP molecule depends on type of molecule broken down carbohydrate most commonly broken down to make  ATP
6 0
3 years ago
During transcription , one side of a DNA molecule is used to make a sequence of RNA. What sequence of RNA would be made from the
polet [3.4K]

Answer:

RNA polymerase uses one of the DNA strands (the template strand) as a template to ... and death, because no new RNAs—and thus, no new proteins—can be made. ... During this process, the DNA sequence of a gene is copied into RNA. Before transcription can take place, the DNA double helix must unwind near the gene

Explanation:

i am sorry if this is wrong

6 0
2 years ago
Write three observations that could help you identify a fish.
Alex
The three observations that could help an individual in distinguising whether the organism is a fish or not is that it should live under water as fish can't survive without water, another thing is that it should laid eggs when it comes to giving birth because when it does not lay eggs but produces a living organism normally without an egg, it is considered to be a mammal and lastly, the appearance it possess such as having gils or fins.
6 0
3 years ago
Read 2 more answers
Other questions:
  • How is it possible for two individuals to have the same phenotype but different genotypes for a trait?
    7·1 answer
  • What is an acid?
    9·1 answer
  • Which kind of wave would be observedusi outer space between planets, where there is very little matter
    10·2 answers
  • A deer is considered a heterotroph because it
    11·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which of the following steps was necessary for the formation of all fossil fuels?
    5·2 answers
  • Help ueu<br> Sf dg dgnegndgndgndg sfns efngensgnsg eyney.eymn
    6·2 answers
  • What affects the rate of diffusion​
    12·1 answer
  • Please help. I don't understand what its asking.
    7·2 answers
  • Considering that the 2006 median U.S. salary for a dual-income household is $58,472 (U.S. Census Bureau), how much would you be
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!