1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tekilochka [14]
3 years ago
5

If you wanted to add a column for the protist species Amoeba proteus, what taxonomic category, if any, would it have in common w

ith the other organisms in the chat?

Biology
1 answer:
ankoles [38]3 years ago
3 0
I believe the answer is No; It would not share any taxonomic category with any other organisms in the chat; simply because it is in a different kingdom. 
Amoeba are eukaryotes whose bodies most often consist of a single cell. The cells of amoebae, like those of  other eukaryotes, possess certain characteristic features. Their cytoplasm and cellular components are enclosed within a cell membrane. 
You might be interested in
Two organisms have analogous structures. A student concluded that these organisms must have a common ancestor is the student cor
arsen [322]

Answer:

The student is wrong, just because the analogous structures of any two organism may have the same structure or even have the some relation between there way of operation or functions.

Explanation:

  • <u>Analogous Structures:</u>

As the similarity between two or more different organisms structure or any organ does not means that they have same ancestors or have the common origin from which the evolve into two different species. Now analogous structures are very much similar in there structure physically, but two different organisms may use them for the same function, which is astonishing to see or observe in way different species.

  • <u>For example:</u>

As the structure of the flipper of a Dolphin has similarity with the phalanges of a human being and with the wings of the bat. As all of them functions for the basic need of movement or locomotion from one point to another. While, all the three species are very much different in there features and are not the same obviously.

<u></u>

4 0
3 years ago
What are the steps taken for the conservation of rare animals in nepal​
emmasim [6.3K]

Answer:

the steps are

we need to keep tight security system in forest area

hunting of animal must be stopped

3 0
3 years ago
The breakdown of chlorophyll reveals the _____ pigments of a leaf.
maks197457 [2]

the breakdown of chlorophyll reveals the carotenoid pigments of a leaf.

I hope this helps!

7 0
3 years ago
Explain how to mandate a change to coal/natural gas use (home/food)
Sauron [17]
Conserve hot water.. check on the heating system and the water heater..
6 0
3 years ago
Hi hi hi hi what is the overall electric charge of neon:))
Pani-rosa [81]

Answer:

Table of Common Element Charges

Number Element Charge

8 oxygen 2-

9 fluorine 1-

10 neon 0

11 sodium 1+

Explanation:

5 0
4 years ago
Read 2 more answers
Other questions:
  • What effect might increased atmospheric carbon dioxide have on the environment?
    15·1 answer
  • Which biotic feature of a watershed helps prevent flooding?
    9·1 answer
  • Why do animals such as a hedgehog<br> hibernate during the cold winter<br> months?
    11·1 answer
  • What are three different shapes, or structures of carbon based molecules
    5·1 answer
  • Diagram by Explore Learning
    7·1 answer
  • Oil _____.
    11·1 answer
  • Which of the following would NOT be an example of Genetic
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • The DNA strand and pre-mRNA strand are anti-parallel. With this in mind label the 3' and
    5·1 answer
  • Which statment describes the relationship
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!