1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
3 years ago
15

Section 1 and 2 Summative Assignment: Heat and Heat Transfer

Biology
1 answer:
Nitella [24]3 years ago
8 0

Answer:

Socratic app it will help you

You might be interested in
Why do enzymes lose their function when they are subjected to extreme temperature changes?
11111nata11111 [884]

It's A. Temperature changes modify the enzyme shape, so they no longer fits.

4 0
3 years ago
What process is shown in figure A?<br> What process is shown in Figure B?
lukranit [14]

Answer:

Figure A: active transport

4 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
The graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What’s the most likely expl
skad [1K]
Elbow dysplasia is an inherited developmental abnormality that affects the elbow joint of dogs. It is accepted that the offspring of <span>a </span>dog<span> with the condition are likely </span><span>to develop the condition themselves. Therefore, the likely answer is:  '</span>It has low diversity in its genes'. Even though the dog is a mixed breed, it is possible that one or both parents carried the gene for a predisposition to elbow dysplasia. 
8 0
3 years ago
Read 2 more answers
From the right atrium through the tricuspid valve to the __(1)__ through the __(2)__ valve to the pulmonary trunk to the right a
atroni [7]

Answer:

Circulatory system

Explanation:

From the right atrium through the tricuspid valve to the right ventricle through the pulmonary sigmoid valve to the pulmonary trunk to the right and left lungs to the capillary beds of the pulmonary veins to the left atrium to the left ventricle of the heart through the mitral valve, to the aorta through the aortic semilunar valve, to the whole body, to the systemic arteries, to the capillaries of the body tissues, to the systemic veins, to the superior cava vein and inferior cava vein, which enter the right atrium of the heart.

8 0
3 years ago
Other questions:
  • If a child belonged to blood type o, he or she could not have been produced by which set of parents?
    11·1 answer
  • May someone help me please
    9·2 answers
  • Which of the following is not an advantage of asexual reproduction
    7·1 answer
  • Why is down syndrome not curable
    12·1 answer
  • True or False we can understand why we see natural resources like copper and gold where they are because we understand under whi
    11·1 answer
  • A child who says, “Give cookie,” rather than “Will you give me a cookie?” is demonstrating __________.
    13·2 answers
  • In the female reproductive tract . fertilization normally occurs in the
    10·1 answer
  • PLS HELP! ILL GiVE BRAINLIEST!!! LI NK IS BELOW!! JUST COPY AND PASTE IT!!
    13·2 answers
  • Explain the importance of the surface area to volume of ratio
    14·1 answer
  • Once an experiment is complete which of the following is not a step to be taken with the data
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!