1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol [13]
3 years ago
8

FAST 20 POINTS Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used. Match the words with their

definitions.​

Biology
1 answer:
Leto [7]3 years ago
7 0
TOP to BOTTOM
Transpiration
Evaporation
Precipitation
Condensation
Ground water
Run off
You might be interested in
What are the most likely percentages for offspring of two red/white-feather chicken parents? Hint: Complete a punnett square cro
Stella [2.4K]

Answer:

the last one

Explanation:

3 0
3 years ago
If some wavelengths of light are absorbed by chlorophylls, what happens to
kenny6666 [7]

Answer:

they reflect back to the surroundings

4 0
3 years ago
Read 2 more answers
Which is the expected outcome of combining the DNA of two parents during sexual reproduction?
Novay_Z [31]

Answer:

A child...? Sorry if I'm wrong, this one's kind of confusing me.

Explanation:

8 0
3 years ago
What is the change in elevation between point B and point D?
BartSMP [9]
B. 20m

fillllllllllllll
8 0
2 years ago
Read 2 more answers
On the geological time scale, the Early and Late ____________ are subdivisions of the Cretaceous period.
fiasKO [112]
The first one for your answer
5 0
3 years ago
Read 2 more answers
Other questions:
  • The movement of oxygen from an area of high concentration to an area of low concentration is an example of:
    12·1 answer
  • Which of the following is not associated with translation
    10·2 answers
  • What is the frontal lobe in your brain used for?
    12·2 answers
  • To prevent the disease scientists would most likely recommend that
    7·1 answer
  • HELP please I’ll make the correct answer the brainliest
    14·1 answer
  • How does a scientist answer a scientific question?
    9·1 answer
  • dexter is doing a report on a prokaryotic organism. He has stated that this organism is unicellular and contains cytoplasm. Whic
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Similarities among vertebrate embryos suggest evolution from a common ancestor. * True or False?​
    8·1 answer
  • Using scientific language explain first why the earth goes through seasons (winter, spring, summer, fall) and then explain speci
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!