1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harkovskaia [24]
3 years ago
9

Which organism would be the least affected by the toxic mercury?

Biology
1 answer:
Zigmanuir [339]3 years ago
7 0

Answer:

Zooplankton(A)

Explanation:

Because the toxic mercury builds up in the bigger organsims

You might be interested in
What will happen to the rate of
MissTica

The answer is B. Not A or C. B. Now go get it right

8 0
2 years ago
Read 2 more answers
What is one difference between dna and rna?
OleMash [197]
D
Cos Dna contains deoxyribose, Rna ribose
8 0
3 years ago
1.
Greeley [361]

1.Aerobic respiration takes place in the mitochondria and requires oxygen and glucose, and produces carbon dioxide, water, and energy. The chemical equation is C6H12O6 + 6O2 → 6CO2 + 6H2O (glucose + oxygen -> carbon dioxide + water).

2.Respiration occurs when glucose (sugar produced during photosynthesis) combines with oxygen to produce useable cellular energy. This energy is used to fuel growth and all of the normal cellular functions.

3.A fundamental task of proteins is to act as enzymes—catalysts that increase the rate of virtually all the chemical reactions within cells. Although RNAs are capable of catalyzing some reactions, most biological reactions are catalyzed by proteins.

4.Aerobic respiration is characteristic of eukaryotic cells when they have sufficient oxygen and most of it takes place in the mitochondria.

5.The end product of anaerobic respiration is lactic acid instead of carbon dioxide and water. ... Hence, the amount of oxygen required to oxidize lactic acid to carbon dioxide and water is not present. Aerobic respiration produces 38 ATP whereas anaerobic respiration produces only 2 ATP molecules.

6.Anaerobic respiration occurs when the amount of oxygen available is too low to support the process of aerobic respiration. There are two main types of anaerobic respiration, alcoholic fermentation and lactic acid fermentation.

7.The end products of anaerobic respiration are Lactic acid or ethanol and ATP molecules. Anaerobic respiration takes place in the absence of oxygen and is seen in lower animals. During the process of Anaerobic Respiration in prokaryotes, there is a breakdown of glucose to produce energy for cellular activities.

8.Complete double ciruculatory systems allow for higher metabolic rates to be maintained as there is no mixing of oxygenated and deoxygenated blood. This means that blood leaving the heart to travel to the body is rich in oxygen.

9.ATP functions as the energy currency for cells. It allows the cell to store energy briefly and transport it within the cell to support endergonic chemical reactions. The structure of ATP is that of an RNA nucleotide with three phosphates attached.

10.Muscles cells contain more mitochondria because they have to release large amount of energy quickly for movement.

11.Carbohydrate loading is a type of diet where foods high in carbohydrates are eaten a few days prior to or right before an event; this is believed to help aid and provide energy during long- term endurance events. ... Carbohydrates are broken down by the body and turned into glycogen; which is stored in muscles.

12.Aerobic respiration takes place in presence of oxygen; whereas anaerobic respiration takes place in absence of oxygen. Carbon dioxide and water are the end products of aerobic respiration, while alcohol is the end product of anaerobic respiration. Aerobic respiration releases more energy than anaerobic respiration.

13.More blood is pumped to the exercising muscles to deliver that additional O. Without enough oxygen, lactic acid will form instead. Lactic acid is typically flushed from the body within 30 to 60 minutes after finishing up a workout. Tiny tears form in the muscles that help them grow bigger and stronger as they heal

14.The overall process of glycolysis is: Glucose + 2 NAD+ + 2 ADP + 2 Pi → 2 pyruvate + 2 NADH + 2 H+ + 2 ATP.

15.During these times, your respiratory and cardiovascular systems cannot transport oxygen to your muscle cells, especially those in your legs, fast enough to maintain aerobic respiration. To allow the continuous production of some ATP, your muscle cells use lactic acid fermentation.

7 0
3 years ago
What is a neutron?
Ierofanga [76]
The answer is B . Neutrons are found in nucleus
5 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • What method do bacteria reproduce? What is it called?
    10·1 answer
  • Write two facts about any five fruits and five vegetables
    10·1 answer
  • Which shows the levels of organizational hierarchy listed from least complex to most complex?
    15·2 answers
  • Many Japanese people consume a diet rich in seaweed, including the edible red alga Porphyra, which is used for preparing sushi.
    15·1 answer
  • Which of the following describes a factor that would limit the carrying capacity of a population within a particular ecosystem?
    10·2 answers
  • __________ is the regulation of internal conditions within a range that supports life processes.
    10·1 answer
  • Meanings for A.carbohydrates B.fibres C. balanced D. diet E. proteins F. fat G.constipation​
    5·1 answer
  • BRAINLIEST:
    15·2 answers
  • All nucleotides of DNA and RNA contain a
    6·2 answers
  • Widow's peak is dominant to straight hairline, and freckles are dominant to no freckles.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!