1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
My name is Ann [436]
3 years ago
6

By what process do glucose and fructose bond together to form sucrose (D)? What is the by-product of this reaction?

Biology
2 answers:
stealth61 [152]3 years ago
7 0

Answer:

Sucrose is formed when a monomer of glucose and a monomer of fructose are joined in a dehydration reaction to form a glycosidic bond. In the process, a water molecule is lost. By convention, the carbon atoms in a monosaccharide are numbered from the terminal carbon closest to the carbonyl group. In sucrose, a glycosidic linkage is formed between carbon 1 in glucose and carbon 2 in fructose.

Explanation:

Disaccharides  form when two monosaccharides undergo a dehydration reaction (also known as a condensation reaction or dehydration synthesis). During this process, the hydroxyl group of one monosaccharide combines with the hydrogen of another monosaccharide, releasing a molecule of water and forming a covalent bond. A covalent bond formed between a carbohydrate molecule and another molecule (in this case, between two monosaccharides) is known as a glycosidic bond. Glycosidic bonds (also called glycosidic linkages) can be of the alpha or the beta type.

Lesechka [4]3 years ago
4 0

Answer: dehydration synthesis; water

Explanation:

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
larry is taking a walk in the park. the pollen in the air makes him sneeze constantly. what line of defense is his immune system
EastWind [94]
The correct answer of the given question above is option A. The line of defense that his immune system is exhibiting in this situation is the first line of defense. The first line of defense includes the physical or external line of defense of the body that are responsible for inhibiting of the entry of foreign microorganisms. Such include the skin, tears, cilia, mucus, urine flow and even stomach acid.
5 0
3 years ago
Read 2 more answers
Starch and ATP can both be described as molecules that store energy. Compare and contrast starch and ATP in terms of storing ene
Debora [2.8K]
Starch is a quick supplier of energy, while ATP is stored energy that is broken apart into ADP when the immediate energy runs ous
6 0
3 years ago
To be considered a living thing an organism must be able to a.move independently B.adapt to change c. Produce oxygen d.increase
Shkiper50 [21]
The answer is D. increase in size
4 0
3 years ago
Read 2 more answers
What are the structures that are located in the chloroplast that make photosynthesis work (multiple choice)
sweet-ann [11.9K]

Answer:

thylakoid

yay plants!!!

5 0
2 years ago
Other questions:
  • 1. What are 3 examples of carbohydrates and what functions do they serve in organisms' bodies?
    11·1 answer
  • A person who fakes symptoms for a goal is called a _________, while a person who fakes a disease for no clear goal has a _______
    9·2 answers
  • What processes can change weathered rock particles into solid rock?
    15·1 answer
  • Which of the following is attached to the transfer RNA (TRNA)? *
    13·1 answer
  • Enzymes , last question pls help
    13·2 answers
  • Which of the following organisms are able to take energy from the sun and make it usable for living things?
    8·1 answer
  • What is one possible positive outcome of global warming?
    8·1 answer
  • What are two kinds of molecules that make a good model of a solid dissolving in a liquid?
    6·1 answer
  • In a population, when the birthdate becomes higher than the death rate, the populations growth rate
    10·1 answer
  • Describe The relationship among cells, tissues, organs and organ systems in the body
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!